Labshake search
Citations for Qiagen :
1001 - 1050 of 5860 citations for rno mir 542 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and total DNA was eliminated using RNase-free DNase set (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... RNA samples were digested with an RNase-free DNase set (Qiagen) to remove genomic DNA and further purified using the RNeasy kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNase treatment was performed using RNA-free DNase Set (QIAGEN, Maryland) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was used for RNA isolation using RNase-Free DNase Set (Qiagen) as specified by manufacturer ...
-
Senescence-Induced Immune Remodeling Facilitates Metastatic Adrenal Cancer in a Sex-Dimorphic MannerbioRxiv - Cancer Biology 2022Quote: ... DNases were removed using the RNase-Free DNase Set (Qiagen, 79254) and subsequently purified using the RNeasy MinElute Cleanup Kit (Qiagen ...
-
bioRxiv - Systems Biology 2022Quote: ... and genomic DNA was removed using RNAse-Free DNase Set (Qiagen). Two replicates of each condition were sent to GENEWIZ (NJ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene set enrichment analysis (GSEA) and Ingenuity Pathway Analysis (IPA, QIAGEN Inc. ...
-
bioRxiv - Developmental Biology 2021Quote: ... including a treatment with DNase I (RNase-Free DNase Set, Qiagen). The quality and quantity of RNA were determined using Agilent RNA 6000 pico kit on the Agilent 2100 Bioanalyzer.
-
bioRxiv - Plant Biology 2020Quote: ... DNA removal was performed using RNase-Free DNase Set (QIAGEN, Germany). Eleven samples from myc2-3 plants detected more than 50% reads mapped to latent virus genome ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNAse treatment was performed using the RNase-free DNase set (Qiagen). RNAseq was performed at the Ramaciotti centre for genomics (UNSW) ...
-
bioRxiv - Immunology 2021Quote: ... and treated in-column with DNase (RNase-Free Dnase Set; QIAGEN) for 15 minutes ...
-
bioRxiv - Immunology 2021Quote: ... including a DNase treatment using the RNase-Free DNase Set (Qiagen). Next ...
-
bioRxiv - Immunology 2021Quote: ... and given on-column DNase treatment (RNase-Free DNase Set; QIAGEN) for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then depleted for DNA using RNase-Free DNase Set (Qiagen). RNA quality and quantity was determined using the Tapestation 2200 and Qubit ...
-
bioRxiv - Cell Biology 2022Quote: ... including a DNase digestion step using RNase-Free DNase Set (Qiagen). Quality control of all RNA samples was performed using a 2200 Tapestation and High-sensitivity RNA screentape (Agilent ...
-
bioRxiv - Plant Biology 2022Quote: ... including an on-column DNAse treatment (Qiagen RNAse-free DNAse set). These were the same plants used for LC-MS/MS V12 ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was treated with RNase-free DNase I set (QIAGEN). RNA-seq library construction and RNA sequencing were performed by BGI Tech Solutions (Hong Kong).
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA was treated with RNase-Free DNase Set (Qiagen, 79254) to remove the contaminating DNA ...
-
bioRxiv - Pathology 2023Quote: ... DNA digestion was performed using the RNase-Free DNase set (Qiagen). Total RNA was then subjected to ribosomal-RNA depleted RNA sequencing (RNA-Seq ...
-
bioRxiv - Plant Biology 2023Quote: ... Residual DNA was removed using the RNase-free DNase Set (Qiagen). Concentration of RNA extracts was determined using a spectrophotometer (Implen ...
-
bioRxiv - Plant Biology 2023Quote: ... Residual DNA was removed using the RNase-free DNase Set (Qiagen). Concentration of RNA extracts was determined using a spectrophotometer (Implen ...
-
bioRxiv - Molecular Biology 2023Quote: ... with on-column DNase digestion (RNase-Free DNase Set, QIAGEN, 79254) to remove DNA ...
-
bioRxiv - Genomics 2023Quote: ... each set of DEGs were loaded in Ingenuity Pathway Analysis (Qiagen) and examined for shared dysregulation of pathways in the two knockout lines relative to the parental UL3 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... additional DNase digestion was performed using RNase-Free DNase Set (Qiagen) to completely remove genomic DNA.
-
bioRxiv - Developmental Biology 2023Quote: ... Contaminating genomic DNA was removed by RNase-Free DNase Set (QIAGEN). RNA concentrations were measured on a spectrophotometer (DS-11+ ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... On-column DNA digestion with the RNase-free DNase set (Qiagen), followed by treatment with Ambion TURBO DNase (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RNA samples were then treated with RNase-free DNase set (Qiagen) to remove gDNA contamination ...
-
bioRxiv - Pathology 2024Quote: ... including on-column DNA digestion (RNase-Free DNase Set, 79254, QIAGEN). RNA from human liver tissue and human cirrhotic PCLS was isolated using Tri Reagent (T9424 ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... The CLC gene set enrichment test (version 1.2, Qiagen, Venlo, Netherlands) was done with default parameters and based on the GO term ’biological process’ (H ...
-
bioRxiv - Plant Biology 2023Quote: ... DNAse treatment was performed using an RNase-Free DNase set (QIAGEN) to remove any DNA contamination ...
-
bioRxiv - Plant Biology 2024Quote: ... then a DNAse treatment with an RNase-Free DNase Set (QIAGEN) and a purification step using lithium chloride precipitation were performed ...
-
bioRxiv - Cell Biology 2023Quote: ... and DNase treatment was performed using RNase-free DNase Set (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA solution was digested with the RNase-free DNase set (Qiagen), followed by on- column DNase digestion to eliminate any remaining traces of genomic DNA ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... SLE mice were retro-orbitally injected with 10 mg/kg of LNA-miR-22-3p (LNA-22) or scrambled control (LNA-Scr) (miRCURY LNA Inhibitor probe in-vivo, Qiagen) every 2 weeks beginning at 10-12 weeks of age ...
-
bioRxiv - Neuroscience 2020Quote: ... The total RNA including the miRNA fraction was isolated using a miR-Neasy Mini kit (Qiagen Benelux, Venlo, the Netherlands) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Cancer Biology 2022Quote: c-miR isolations from blood serum were carried out using affinity column-based miRNeasy Serum/Plasma Advanced Kit (217204, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was generated from CSF isolated RNA and a control RNA sample spiked with miR-39 (1 × 108 copies/ul) using the miScript HiSpec kit (Qiagen); dilutions were created from the control cDNA sample spiked with miR-39 (1 ×106-1×103 copies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells incubated for 24 hours in a 37 °C incubator and transfected with hsa-miR-24-3p miRCURY LNA miRNA Power Inhibitor (Qiagen, Germantown ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Genomics 2020Quote: ... We used 0.5 ng of total RNA per tissue sample supplied with Cel-mir-39 spike-in (Qiagen, cat# 339390) to perform the reactions in a final volume of 20uL.
-
bioRxiv - Physiology 2022Quote: ... Total RNA was isolated from 200 μL mouse serum following a standardized protocol (PMID: 24357537) using the miRNeasy Serum Plasma kit with ce-miR-39 spike-in (QIAGEN), QIAcube (QIAGEN ...
-
bioRxiv - Genomics 2022Quote: ... were used according to the manufacturer’s manual: the miRNeasy Serum/Plasma Kit (abbreviated to MIR in this study; Qiagen, 217184), miRNeasy Serum/Plasma Advanced Kit (MIRA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or to mature primate-specific miR-608 (AM608, 15-mer, as a control with no predicted complementary sequences in mice) (LNA, Exiqon, Qiagen). DIO mice were injected intravenously with 3.3 mg/kg oligonucleotide for three consecutive days and were sacrificed 0 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Developmental Biology 2021Quote: 5ng/sample RNA isolated from sperm was reverse transcribed (RT) using the miCURY LNA RT kit (Qiagen #339340). Quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Immunology 2021Quote: ... 0.25μL of 2X QuantiFast RT Mix (QIAGEN), and PCR-grade water (fill to 20 μL) ...