Labshake search
Citations for Qiagen :
1001 - 1050 of 1325 citations for Recombinant Human ROR1 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... mRNA-Seq FASTQ reads were mapped to the human reference genome (Homo sapiens v81; hg38) using default options on CLC Genomics Workbench 11 (Qiagen). Total gene reads (with at least 1 read count ...
-
bioRxiv - Genomics 2020Quote: RNA isolation for all the 248 human subjects were performed using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The isolated RNA was subjected to qPCR for determining viral load by Ct values ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from human fibroblasts as well as iNs from the same lines using the miRNeasy kit (Qiagen) followed by Universal cDNA synthesis kit (Fermentas) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng of genomic DNA derived from sorted neuronal and non-neuronal nuclei of a postmortem human ACC sample (Brain A) was used for bisulfite conversion (EpiTect Bisulfite Kit, Qiagen). For each sample ...
-
bioRxiv - Cancer Biology 2021Quote: RNA/DNA was isolated from the macro-dissected xenografts (injected/contralateral side, separately) and human GBM (AllPrep DNA/RNA Mini Kit, Qiagen). The ratio of human/mouse cells in the xenografts was estimated by species specific PCR (DNA ...
-
bioRxiv - Developmental Biology 2022Quote: RNA samples from freshly thawed human primary hepatocytes (SMC and AQL) or from PSC-hepatocytes were prepared with RNeasy plus micro kit (Qiagen), and 10-20 ng total RNA samples were used for constructing stranded RNA libraries with Swift RNA-seq library preparation kit and sequenced with an Illumina HiSeq 2500 sequencer with 50 base single end reads.
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... both hNS1 and hNP cells were transfected with human miRNA-mimics (double stranded RNAs that mimic mature endogenous miRNAs, Procured from Qiagen) of the mentioned ...
-
bioRxiv - Bioengineering 2020Quote: Total DNA samples were obtained from human skin biopsy samples (XX, caucasian, 79 yr) using the QIAamp DNA Mini Kit (Qiagen) and applied to the human Illumina Infinium EPIC 850K chip ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... high molecular weight genomic DNA (gDNA) was purified from human primary T cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were purified by immobilized metal affinity chromatography according to the manufacturer’s protocol (Qiagen), followed by gel filtration in 50 mM sodium citrate buffer (pH 5.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The proteins were first purified by chromatography on a Ni-NTA agarose column (QIAGEN), and then further purified on a HiTrap Heparin column (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested with 30 μL of Proteinase K II (QIAGEN, GmbH, Hilden, Germany). DNA was washed with AW1 and AW2 buffers (QIAGEN ...
-
bioRxiv - Biophysics 2019Quote: ... The protein present in the supernatant was purified using a Ni-NTA column (Qiagen). The protein was eluted by increasing the concentration of imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... proteins were blotted onto PVDF membrane and examined with an RGS-His4-antibody (Qiagen) and a 1:2500 dilution of the fluorophore-conjugated secondary antibody Cy3 (ECL Plex goat-α-mouse IgG-Cy3 ...
-
bioRxiv - Biochemistry 2020Quote: ... The target proteins were purified by affinity chromatography using a Ni-NTA column (Qiagen) with the lysis buffer supplemented with 20 mM and 200 mM imidazole serving as the washing buffer and elution buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... The soluble hEKL proteins were purified using a Ni-NTA agarose resin (Qiagen, Germany) and subsequently HiLoad 16/60 superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Bioengineering 2020Quote: ... The soluble protein fraction was then purified with pre-equilibrated Ni-NTA resin (Qiagen), recovered in elution buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was purified by affinity chromatography using Ni-NTA agarose (Qiagen, Hilden, Germany), followed by gel filtration chromatography ...
-
bioRxiv - Cell Biology 2021Quote: ... We purified the 6xHIS fusion protein on nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... and proteins were purified by IMAC using Ni-NTA spin columns (QIAGEN, Hilden, Germany). Proteins were eluted in 100 μL elution buffer (50 mM sodium phosphate pH 8.0 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Uncleaved protein with 6xHisTag were isolated from the lysate using Ni-NTA resin (Qiagen). The flow-through (FT ...
-
bioRxiv - Biophysics 2019Quote: ... Proteins were purified by immobilized metal affinity chromatography according to the manufacturer’s protocol (Qiagen), followed by gel filtration in 10 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Bioengineering 2019Quote: ... The secreted protein was purified from the supernatant using Ni-NTA agarose resin (Qiagen) as previously described46 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Network analysis of identified proteins was then performed using Ingenuity Pathway Analysis software (Qiagen).