Labshake search
Citations for Qiagen :
1001 - 1050 of 3281 citations for Fipronil 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Bioengineering 2021Quote: ... Sample supernatants were incubated with 4 mL of Ni-NTA Agarose (Qiagen) for >1 hour at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Neuroscience 2023Quote: ... FACS-sorted cells (≈ 98% tdTomato+ cells) were harvested in RLT and RNA extracted with RNeasy Micro kit (Cat. # Qiagen). Around 100 000 tdTomato+ cells were sorted from 10 electroporated-brains for each sample to sequence ...
-
bioRxiv - Physiology 2019Quote: ... DNA was extracted from 5 µL of RBCs using the Gentra Puregene Tissue Kit (Qiagen) and kept frozen at −80°C until analysis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and homogenized with 5 mm stainless steel beads on a Tissue Lyzer II (Qiagen 85300) at 30 Hz for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: 5 µg of RNA of was cleaned up using using RNeasy mini prep column (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... The worms were homogenized with a 5□mm steel bead using a TissueLyser II (Qiagen) for 2□×□2.5□min at a frequency of 30 times/sec ...
-
bioRxiv - Neuroscience 2020Quote: ... Powdered tissue (∼5 mg) was dissolved in lysis buffer provided by RNeasy micro kit (Qiagen), supplemented with 1% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... for 5 mins and then neutralized by addition of Qiagen N3 neutralization buffer (Qiagen, 19053). Subsequently ...
-
bioRxiv - Physiology 2022Quote: ... Samples were homogenized using a TissueLyser II device (Qiagen; 5 min at 30 pulses/second) in 425 μL water ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 5 × 106 cells using Qiagen DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... phagocytosed by sorting cells into a 96 well plate containing 5 ul of RLT (Qiagen) + 1%β-Mercaptoethanol (Sigma).
-
bioRxiv - Molecular Biology 2020Quote: ... whole worms were homogenized with a 5 mm steel bead using a TissueLyser II (QIAGEN) for 5 min at frequency of 30 times/second ...
-
bioRxiv - Biophysics 2022Quote: ... Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen, Germany). Both inserts and vector were eluted and stored in 10 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from 5 million cells using RNeasy Plus Universal Kits (Qiagen, #73404) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... single-cells were sorted in 96-well plates containing 5 µL of TCL buffer (Qiagen) with 1% β-mercaptoethanol according to the gating strategy shown in Fig ...
-
bioRxiv - Pathology 2023Quote: Mouse tissues were homogenized with a 5 mm steel bead using a TissueLyser II (QIAGEN) for 5 min at frequency of 30 times/second ...
-
bioRxiv - Physiology 2023Quote: ... using a Qiagen TissueLyser LT bead mill and 5-mm stainless steel beads (Qiagen, #69989). RNA was isolated from the samples using the NucleoSpin RNA kit ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA purified from 5-dpf embryos with the miRNeasy Mini Kit (Qiagen, catalog #: 217004). Using this cDNA library ...
-
Sex-specific fear acquisition following early life stress is linked to amygdala glutamate metabolismbioRxiv - Animal Behavior and Cognition 2024Quote: ... which had been preprocessed with 5 mm metal balls in a TissueLyser (Qiagen, TissueLyser LT) for 1 minute at 25 Hz ...
-
bioRxiv - Systems Biology 2023Quote: ... 1.6 mL per 100 mL culture of homemade buffer P2 (according to the manufacturers protocol, QIAGEN, Hilden, Germany) was added ...
-
bioRxiv - Biophysics 2020Quote: ... Cells lysates were treated with 100 μg/mL of RNase A (Qiagen). Lysates were cleared by centrifugation and then incubated with Glutathione-Sepharose 4B resin (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Microbiology 2022Quote: ... each sample was eluted in 40.5 µL elution buffer that was prepared by mixing 98 µL Buffer EB (Qiagen, CN 19086), 1 µL 10% Tween 20 (Teknova ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Pathology 2019Quote: ... The Pparα deletion was confirmed with PCR and HotStar Taq DNA Polymerase (5 U/μl, Qiagen) using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... Frozen tissues were placed into tubes containing a 5 mm stainless steel bead (Qiagen, Courtaboeuf, France) and 1 ml of Trizol reagent (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 mM Tris pH 8.0) using 5 mM stainless steel beads in a TissueLyser II (Qiagen). In vitro TPP1 assay was performed as described ...
-
Establishment of Wolbachia strain wAlbB in Malaysian populations of Aedes aegypti for dengue controlbioRxiv - Microbiology 2019Quote: ... Mosquitoes were homogenised in 175 µL of 5% Chelex® solution using TissueLyser II machine (Qiagen) and with 5 µL of proteinase K (20 mg/mL ...