Labshake search
Citations for Qiagen :
1001 - 1050 of 2414 citations for 8 Chloro 2 methylimidazol 1 2 a pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The cells were harvested 8-21d post-transfection and genomic DNA and RNA were immediately collected (Qiagen; DNeasy #69504 and RNeasy #74106 ...
-
INTEGRATE: Model-based multi-omics data integration to characterize multi-level metabolic regulationbioRxiv - Systems Biology 2021Quote: Total RNA was extracted from at least 8 x 106 cells by using RNeasy Mini Kit (Qiagen). Each pellet was resuspended by adding 30 μL of RNAse-free water ...
-
bioRxiv - Biochemistry 2020Quote: Initial hits of Nic96186-839-VHH-SAN12 were obtained at 18 °C in 1 day in a 96-well sitting drop tray with a reservoir containing 8% (w/v) PEG 8,000 and 0.1 M tri-sodium citrate pH 5.0 (Protein Complex suite, Qiagen). Hanging drops of 1 ml protein at 6mg/ml and 1 ml of precipitant (7-10% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 to 10 independent PCR reactions were pooled together and purified using the PCR purification kit (Qiagen). Multiplexed libraries were sequenced on Illumina HiSeq 2500 to obtain 100 bp single-end reads ...
-
bioRxiv - Cancer Biology 2019Quote: Cell lysates were harvested following an 8 hour E2 or DMSO control induction with buffer RLT plus (Qiagen) containing 1% beta-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Biochemistry 2021Quote: Total RNA was extracted from HKC-8 or mouse kidneys using the miRNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Embryos and endosperms were collected 8 days after cross and total RNA was extracted using RNAeasy kit (Qiagen) plus in-column DNase digestion ...
-
bioRxiv - Molecular Biology 2023Quote: DNA was isolated from the cells on day 8 after transduction using QiaAMP DNA blood mini kit (Qiagen) as per the manufacturer’s protocol and eluted in nuclease free water.
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from cSCC cell lines (n = 8) and NHEKs (n = 4) using miRNeasy Mini Kit (Qiagen), and the RNA-seq analysis was performed using Illumina HiSeq2500 system using paired-end sequencing chemistry with 100bp read length (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH = 8) and genomic DNA was isolated as described previously53 with the following modifications: QIAGEN Protease ((#19157, QIAGEN) and PureLink RNAse A ((#12091021 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Zoology 2020Quote: ... Two independent replicates were performed in 8 μl of volume containing 0.5 U of Hot Start Taq polymerase (Qiagen), 0.18 μM of each primer and 0.04 mg of Bovine Serum Albumin Fraction V (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and human BON1 cell line [8] were isolated with RNeasy Plus Universal Kits (Qiagen Cat no. 73404, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The solubilized membranes were centrifuged in a Sorvall WX ultracentrifuge (~109,000 g; 45 min, F50L-8×39 rotor) and the supernatant was incubated with Ni-NTA resin (Qiagen) for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2019Quote: ... 700 μL of cold methanol and 140 μL of EDTA 0.1M were added and vigorously mixed (4 x 45 s) in a mini-bead-beater-8 (Biospec Products, Qiagen). By this way ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 8 were transfected with a pool of cytotoxic siRNAs (“AllStars” wells, positive control, Allstars maximal death control, Qiagen). Briefly ...
-
bioRxiv - Genetics 2021Quote: Relative telomere length of MDS patients was measured by quantitative polymerase chain reaction (qPCR) as previously reported.8 K562 cell DNA was extracted using the QIAamp Blood Mini kit (Qiagen). Telomere length was measured by two orthogonal methods ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pH 5.8) under long day condtions (16h light) at 24 °C (day) 22 °C (night) using the DNeasy Plant Kit (Qiagen). ONSEN copy numbers were determined by qPCR using 12 ng total DNA using the KAPA SYBR FAST master mix universal on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Cancer Biology 2021Quote: All RNA was extracted from pellets of cultured cells (passage numbers ranging from 8-14) and cryosections of snap frozen tumor material with the RNeasy Plus Mini Kit (Qiagen).
-
bioRxiv - Genetics 2021Quote: ... The gDNA pellet was dissolved in 1mL TE pH 8 buffer and incubated with RNase A with a concentration of 100ug/mL (Qiagen) for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Total RNA was isolated from HLMEC after 8 h of NP exposure with the RNeasy Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Genomic DNA was prepared from cryosectioned material by dissolving 8-μm sections in Buffer AL and purifying with the DNeasy Blood & Tissue kit (Qiagen). Whole-exome sequencing at 100x coverage was performed as a contract service with Genewiz ...
-
bioRxiv - Neuroscience 2021Quote: A total of 8 frozen brain samples (five controls and three infected with ZIKV) were processed in TissueLyser® (Qiagen) for 30 seconds at 30Hz for cell disruption ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
The mitochondrial genome of the red icefish (Channichthys rugosus) casts doubt on its species statusbioRxiv - Zoology 2022Quote: A small piece of muscle tissue (5.8 mg dry weight) was dried in a vacuum centrifuge and immersed in lysis buffer (260 μL ATL buffer (Qiagen) and 40 μL Proteinase K [20 mg/mL]) ...
-
bioRxiv - Microbiology 2022Quote: For RNAseq the pellets were resuspended in 150 µL 10 mM Tris-HCl pH 8 and mixed with 700 µL of ice cold RLT+BME (RLT buffer (Qiagen) supplemented with 1% β-mercaptoethanol ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Microbiology 2019Quote: A549 or DF-1 cells in 6-well plates were infected with the specified IAVs and total RNA was extracted 8 hpi using a RNeasy Kit (Qiagen). Total RNA was eluted in RNase-free water and stored at −80 °C until needed.
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... total RNA was extracted from aerial parts of nine-leaf stage seedlings collected at 8 h after dawn using RNeasy mini kit (Qiagen) with DNase treatment (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA for PIWIL3 5′ RACE was extracted from the ovaries of 8-week-old golden hamsters using ISOGEN (Nippon Gene) and RNeasy (Qiagen). 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: The validated Alx1DN (N-terminal portion of protein product containing homeodomain and nuclear localization domains) clones in pCS2+8 were purified via miniprep (Qiagen) alongside a control (C-terminal portion containing transactivation domain) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was harvested following an 8 hour DMSO or 10 nM E2 induction with buffer RLT plus (Qiagen, 1053393) supplemented with 1% beta-mercaptoethanol (Sigma Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... 8 cm of leaf tissue was harvested on ice and then lyophilized using a TissueLyser II (Qiagen, Valencia, CA, USA). Genomic DNA was extracted using a Qiagen DNeasy Plant Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from Arabidopsis seedlings (8 seedlings per sample) using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) 24 h after the elicitor treatment ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated from flash frozen 8 μm thick sections of tibialis anterior muscles embedded in OCT using the RNeasy Mini Kit (Qiagen) and evaluated using the RNA high sensitivity kit (Agilent RNA 6000 Pico Kit ...
-
bioRxiv - Genomics 2023Quote: ... After ligation nuclei were pelleted and resuspended in cold PBS with DAPI to a final concentration of 300nM and GFP+ cells were FAC-sorted into a 96 well plate with 2ul lysis buffer (20mM Tris pH 8, 20mM NaCl, 0.15% Triton X-100, 25mM DTT, 1mM EDTA, 500nM Carrier ssDNA, and 15ug/mL Qiagen Protease) and lysed for 1 hour at 50°C and inactivated 15 minutes at 70°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 75 ng of rRNA was reverse transcribed and amplified with 8 PCR cycles using the OneStep RT-PCR kit (Qiagen) and primers MS2_quant_F and MS2_quant_R (Supplemental Table 5) ...
-
bioRxiv - Microbiology 2023Quote: ... an unbiased amplification method was employed by amplifying the purified DNA at 30°C for 8 hours using a REPLI-g Single Cell kit (Qiagen). The amplified DNA was purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... samples were resuspended in 100 μl TE buffer pH 8 and RNA extraction performed according to the RNeasy Mini Kit (Qiagen) protocol with few modifications ...