Labshake search
Citations for Qiagen :
1001 - 1050 of 1584 citations for 6 chloro 5 methoxy 3 Pyridinecarboxylicacid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from 2000 cells per replicate and 3 replicates per treatment by the micro RNeasy kit (QIAGEN) for both mouse muscle satellite cells and ZeMPCs ...
-
bioRxiv - Genetics 2022Quote: RNA from cortex and hippocampus derived ex vivo cultures was extracted from 3 biological replicates for three time points (DIV3, DIV15, DIV31) using RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using a SuperScript IV Reverse Transcriptase cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was harvested from 2-3 million HIV-dreGFP infected Jurkat cells exposed to EPZ-719 (500nM) or control (DMSO) using a RNEasy kit (Qiagen). RNA quantity and quality were then analyzed by nanodrop and Tapestation (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the FT and Eluate fractions (90 µL each) were mixed with 10 µL 3 M sodium acetate and applied to a QIAquick spin column (Qiagen). Purified DNA was visualized a 1.3% agarose / 0.5x TBE gel and SYBR Green staining ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cell lines in 3 biological replicates after each CRISPR/Cas9 oncogene downregulation using QIAzol (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Neuroscience 2023Quote: ... GFP+ and GFP- nuclei were sorted using a BD AriaFACS III (University of Washington Pathology Flow Cytometry Core) into a PCR tube strip containing 3 µL of REPLI-g Advanced Single Cell Storage buffer (Qiagen). Whole genome amplification (WGA ...
-
bioRxiv - Microbiology 2023Quote: ... tissues were placed in 300μL of sterile PBS containing sterile glass beads and mechanically lysed at a frequency of 20 shakes per seconds for 3 minutes in a TissueLyser II (Qiagen). Negative controls consisted of tubes containing PBS and beads but no sample ...
-
bioRxiv - Microbiology 2023Quote: DNA extraction was carried out with 37 mg of freeze-dried mycelium using the Nucleospin Microbial DNA kit in combination with 3 mm tungsten carbide beads (Qiagen) for tissue disruption in a MM 301 vibratory mill ...
-
bioRxiv - Immunology 2024Quote: ... was added to each tube and homogenized at 30 rev/s for 3 minutes for 2 rounds using a tissue homogenizer/lyser (#9003240, Qiagen). Kidney extracts were centrifuged at 17,000 RCF for 10 minutes and the supernatant was transferred to a 1.5 mL microcentrifuge tube and kept over ice for 1-2h ...
-
bioRxiv - Genetics 2024Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, pr-set720 and parp-1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final samples of 3 or 30 million cells were collected and genomic DNA was extracted (DNeasy blood and Tissue kit, Qiagen). Next ...
-
bioRxiv - Genetics 2024Quote: ... yeast plasmid DNA was extracted from 5x107 cells harvested off of galactose and final glucose plates of replicates 2 and 3 using Qiaprep Spin Miniprep Kit (QIAGEN). We amplified the 200-bp repair template region from the initial E ...
-
bioRxiv - Biochemistry 2024Quote: ... NEO1 3’UTR was isolated from genomic DNA isolated from cultured HEK-293T using DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting homogenates were centrifuged at 13,000 rotations per minute (rpm) for 3 min and RNA in the supernatant was purified using the RNase Mini Kit (Qiagen). A NanoDrop spectrophotometer was used to measure the concentration of RNA in each sample ...
-
bioRxiv - Genomics 2021Quote: ... The eluates were mixed with guanidine– HCl to a final concentration of 6 M and incubated with Ni-NTA sepharose (Qiagen, 100 μl of slurry per sample) o/n at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... All wells were then pooled and diluted 5:1 (∼24 mL) in Buffer PB (Qiagen #19066) with 1/20th volume of 3 M NaOAc pH 5.2 (∼1.2 mL) ...
-
bioRxiv - Pathology 2019Quote: ... The Pparα deletion was confirmed with PCR and HotStar Taq DNA Polymerase (5 U/μl, Qiagen) using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... Frozen tissues were placed into tubes containing a 5 mm stainless steel bead (Qiagen, Courtaboeuf, France) and 1 ml of Trizol reagent (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Biochemistry 2019Quote: ... The soluble fraction was loaded onto a column containing 5 ml Ni-NTA superflow resin (Qiagen), pre-equilibrated with buffer A ...
-
bioRxiv - Immunology 2020Quote: ... The bacterial lysates were mixed for 1 h with 5 ml of Ni-NTA resin (Qiagen) that had been equilibrated with buffer A ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 mM Tris pH 8.0) using 5 mM stainless steel beads in a TissueLyser II (Qiagen). In vitro TPP1 assay was performed as described ...
-
Establishment of Wolbachia strain wAlbB in Malaysian populations of Aedes aegypti for dengue controlbioRxiv - Microbiology 2019Quote: ... Mosquitoes were homogenised in 175 µL of 5% Chelex® solution using TissueLyser II machine (Qiagen) and with 5 µL of proteinase K (20 mg/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified lysate was applied to two tandemly-connected 5 ml Ni-NTA Superflow cartridges (Qiagen); the cartridges were washed with buffer containing 20 mM Tris pH 8.0 ...