Labshake search
Citations for Qiagen :
951 - 1000 of 2235 citations for R 4 Benzyl 2 2 diphenylphosphino benzyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then cultured for an additional 4 weeks and genomic DNA (gDNA) was isolated using DNeasy Blood and Tissue Kit (Qiagen, Cat. # 69506). sgRNA sequences were PCR amplified from gDNA using Platinum SuperFi II DNA Polymerase (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Genomics 2024Quote: ... the Qiagen RNeasy Mini Kit was used according to Qiagen RNA Protect Reagent Handbook Protocols 4 and 7 with Appendix B on-column DNase digestion (Qiagen, Hilden, Germany). The RNA was assessed with UV-Vis spectrophotometry (Denovix DS-11 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Quality of the final library has been evaluated through Qubit 4 and fragments sizes were checked by migration using QIAxcel Advanced Instrument (QIAgen, Hilden, Germany). Fragments ready for sequencing sized between 280bp and 320bp ...
-
bioRxiv - Bioengineering 2024Quote: Whole mouse aortas (n=18 per group) cleaned of perivascular tissue were perfused with sterile HBSS and stabilized overnight at 4◦C in RNAProtect reagent (Qiagen; Hilden, Germany) before long-term storage at -80◦C ...
-
bioRxiv - Bioengineering 2024Quote: ... the extraction of total nucleic acid from transfected MOLT-4 cells (small scale, as described) was performed using a DNeasy Blood and Tissue Kit (QIAgen catalog # 69504) which includes direct lysis with proteinase K treatment ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... striatal and retinal RNA from the same R6/1 mice was pooled (3-4 samples per genotype) and further processed using the clean-up protocol of the RNeasy Mini Kit (Qiagen, Hilden, Germany), which also included on-column DNase I treatment ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA were extracted from the basal stem section of mature Col-0 and msil2/4 mutant plants using the RNeasy Plant Mini Kit (Qiagen, Cat.#74904) and treated onto the column with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... were weighed and homogenized in 1-10 µL/mg DMEM with a sterile glass bead at 30 Hz for 4 minutes using a TissueLyser (Qiagen, Germantown, MD) automated homogenizer ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and RNA from patient tumor tissue biopsies and mouse tumors were extracted from 4 sections of 10 µm each from FFPE tumor blocks using the AllPrep® DNA/RNA FFPE kit (Qiagen #80234) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The lysate was clarified by centrifugation at 20,000 x g for 45 minutes at 4°C and incubated with Ni-NTA agarose resin (Qiagen, catalogue number: 30230) pre-equilibrated with lysis buffer for 2 hours at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... leaf discs (30 mg) were collected 4 dpi and then flash frozen in liquid nitrogen and homogenized with the Tissue Lyser II (QIAGEN, Hilden, Germany) to make fine powder at 300 rpm for 1 min ...
-
bioRxiv - Microbiology 2024Quote: ... Enzymatic lysis and proteinase K digestion of bacteria was performed following protocol 4 in the RNAprotect® Bacteria Reagent Handbook (Qiagen, Germany). Purification of total RNA from bacterial lysate using the RNeasy® Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from whole fecal pellets or 50 µL of in vitro cultures with a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4) or a DNeasy UltraClean Microbial Kit (Qiagen 10196-4) ...
-
bioRxiv - Genomics 2024Quote: ... each using three 4 mm punches, using the GenTegra Complete DNA Recovery Kit (GenTegra, Pleasanton, CA, USA) and the QIAamp Micro Kit (Qiagen, Hilden, Germany), based on Additional File 2 Protocol GQ from Ghantous et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene of interest (GOI) siRNA or control siRNA were incubated at room temperature with Enhancer R and Buffer EC-R (Qiagen, USA) for 20 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ... The 205bp amplicon from PCR 2 was gel extracted using the MinElute gel extraction kit (Qiagen Cat#: 28606), and sent to Genewiz for Amplicon-EZ targeted deep sequencing and Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR #2 products were validated using gel electrophoresis and purified using the QIAquick Gel extraction kit (QIAGEN). The purified libraries were then quantified by Nanodrop and Qubit prior to sequencing on an Illumina MiSeq.
-
bioRxiv - Systems Biology 2021Quote: ... Differences between samples and controls were calculated based on the 2−ΔΔCT method using RNU6 control primer (Qiagen) as normalizer ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was extracted from 2-week-old Arabidopsis seedlings using an RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... single cell directly into 2 µl lysis buffer (30 mM Tris-HCl [pH = 8.0], 10 mM NaCl, 0.2 µL Proteinase K [Qiagen, #19133] ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... The soluble fraction was split between two columns each with 2 ml Ni-NTA agarose beads (Qiagen, 30210) pre-equilibrated with Lysis Buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... The concentrated SPACA6-containing media was applied onto a 2-mL column of Ni-NTA agarose resin (Qiagen). The Ni-NTA resin was washed with 10 column volumes (CV ...
-
bioRxiv - Immunology 2022Quote: ... The upper aqueous phase containing RNA was carefully transferred to a 2 ml collection tube (cat. 990381, Qiagen) without touching the interphase and placed in a QIAcube instrument for extraction.RNA extraction was carried out using the recommended protocol (FIW-50-001-J_FW_MB and PLC program version FIW-50-002-G_PLC_MB ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 RBD-His protein was purified from cell culture supernatant using a Ni-NTA (Qiagen) affinity column ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... Both barcode and digested fragment products were run on a 2% gel and purified by gel extraction (Qiagen). NGS library was sequenced using an Illumina MiSeq and Illumina v3 MiSeq Reagent Kits with 150 base pair single-end sequencing according to standard manufacturer protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were purified from 2% agarose gels via the QIAqick gel extraction kit (QIAGEN cat.#28704) and subjected to next-generation sequencing on a HiSeq instrument lane (Illumina ...
-
bioRxiv - Physiology 2020Quote: Purified total RNA was extracted from fresh BM-MSCs at passage 2 using a Qiagen Minikit (Qiagen, Australia). Quantitative RT-PCR was performed (n=3 mice/group ...
-
bioRxiv - Physiology 2020Quote: ... Groups of five flies were transferred to 2 mL tubes and were homogenized in 100μl PBS + 0.1% Triton X-100 using a TissueLyser LT (Qiagen). The samples were then spun down at 12,000 rpm and the supernatant transferred to fresh vials and the absorbance of each sample at 603 nm was measured using a NanoDrop ...
-
bioRxiv - Genomics 2021Quote: Total RNA was collected from 2×106 CAR T cells with the RNEasy Plus Mini isolation kit (Qiagen). Library preparation and RNA-seq was performed by BGI America (Cambridge ...
-
bioRxiv - Biochemistry 2021Quote: ... brucei genomic DNA was isolated from ∼ 2 × 108 bloodstream form cells using a DNeasy Blood & Tissue Kit (Qiagen) using standard methods.
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... for the SARS-CoV-2 low stringency screen with the QIAmp DNA Blood maxi kit (Qiagen ref. 51194). In a first PCR step ...
-
bioRxiv - Microbiology 2021Quote: Frozen plant tissue was ground using the TissueLyser II (QIAGEN; 2 cycles of 30 seconds at 27 Hz) and 3-mm zirconium oxide beads (Glen Mills Inc.) ...
-
bioRxiv - Immunology 2021Quote: RNA of cells exposed to SARS-CoV-2 was isolated with the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturers protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... using a MiSeq reagent kit v3 with 2 × 75 paired end-reads and sequence analysis was performed using CLC-Genomics workbench (v10.1.1., Qiagen). Enrichment in reads of each sample was compared to the corresponding control and mapped as peaks against the annotated genome of S ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was extracted from 140 µl of virus stock (SARS-CoV-2 VOC Delta, GISAID ID: EPI_ISL_15250227) using a QIAamp Viral RNA Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli grown for 16 h in 250 ml of 2×YT medium using the Plasmid Maxi Kit (QIAGEN) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... approximately 100 mg of adipose tissue and a 7 mm metal bead were placed in a 2 mL centrifuge tube containing 0.5 mL PBS buffer (pH 7.4) and homogenised in TissueLyser II (Qiagen) for 2 minutes at 25 Hz ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was placed into 2-mL round-bottom homogenizer tubes pre-loaded with Stainless Steel beads (#69989; Qiagen) and filled up with lysis buffer (#AA-LYS-16ml ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).