Labshake search
Citations for Qiagen :
951 - 1000 of 10000+ citations for Cow Four And A Half LIM Domains Protein 2 FHL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... total RNA was isolated using RNeasy Mini Kit or Micro Kit (Qiagen). Reverse transcription was performed using M-MLV Reverse Transcriptase and random primers following manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA was extracted using a commercial kit (RNseasy Plant Mini Kit, Qiagen), followed by cDNA synthesis (iSCRIPT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using standard column-based purification kit (QIAGEN RNeasy Kit, Cat. No. 74004). DNase treatment was applied during the purification to remove any potential DNA contamination ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted using the RNeasy Mini Kit extraction kit (QIAGEN). RNA-less and reverse transcriptase-less reactions were used as controls ...
-
bioRxiv - Cancer Biology 2021Quote: ... purified with QIAquick Gel Extraction kit or QIAquick PCR Purification kit (Qiagen), ligated using T4 DNA Ligase (New England BioLabs) ...
-
bioRxiv - Genetics 2020Quote: ... Plasmids were prepared using silica-membrane based kit (Plasmid Miniprep Kit, Qiagen) following the manufacturer’s instructions and quantified using Nanodrop Spectrophotometer ...
-
bioRxiv - Genetics 2020Quote: ... according to the DNeasy Blood & Tissue kit and DNeasy Micro kit (QIAGEN). Total RNA was extracted from pelleted cells using the Rneasy Mini kit (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... using viral RNA isolation kit (QIAmp Viral RNA Mini Kit Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... QIAprep Spin miniprep kit and QIAquick gel extraction kit (Qiagen, Hilden, Germany) were used according to the manufacturer’s protocol to isolate plasmids and to separate PCR products from agarose gels ...
-
bioRxiv - Biochemistry 2023Quote: ... gel extraction kit and PCR clean-up kit was obtained from Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2022Quote: ... QIAGEN Plasmid Maxi Kits and QIAprep Spin Miniprep Kit were from QIAGEN. Zymo PUREII Plasmid Midiprep kit (D4200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA preparation (QIAprep Spin MiniPrep Kit and Plasmid Midi Kit, Qiagen) and gel electrophoresis were performed according to the manufacturer’s instructions or using standard protocols (29) ...
-
bioRxiv - Cell Biology 2023Quote: DNA was extracted using a commercial kit (DNeasy Blood & Tissue kit, Qiagen). For cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and extracted with Jetgene mini prep kit (QIAprep Spin Miniprep Kit, QIAGEN). The correctness of constructions was verified by sequencing (Eurofins) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Qiaspin Miniprep Kit (Qiagen) and Monarch PCR & DNA Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNeasy Mini kit (Qiagen) or miRNeasy Mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... RNeasy Mini Kit (Qiagen), and DNAse I kit (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: RNeasy Mini Kit (Qiagen) was used for RNA isolation ...
-
bioRxiv - Immunology 2021Quote: AllPrep Mini kit (Qiagen) was used for RNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA of each sample was extracted using TRIzol Reagent (Invitrogen)/RNeasy Mini Kit (Qiagen). Control samples were collected from an antibiotic-free culture ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNeasy FFPE kit (Qiagen) were used following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNeasy Mini Kit (Qiagen) was used to isolate total RNA from different breast cancer cell lines i.e ...
-
bioRxiv - Cancer Biology 2020Quote: ... using RNeasy kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: QuickLyse Miniprep Kit (Qiagen). Samples were centrifuged at 100g for 5 minutes to remove large particles ...
-
bioRxiv - Cancer Biology 2019Quote: ... the QIAshredder Kit (Qiagen), and the QIAamp Blood Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA of each sample was extracted using TRIzol Reagent (Invitrogen)/RNeasy Mini Kit (Qiagen)/other kits and was quantified and qualified by Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Qiagen DNeasy kits (Qiagen) were used for DNA extraction ...
-
bioRxiv - Evolutionary Biology 2019Quote: Qiagen DNeasy kits (Qiagen) were used for DNA extraction ...
-
bioRxiv - Bioengineering 2021Quote: ... RNeasy Mini-Kit (Qiagen) purified mRNA from total RNA ...
-
bioRxiv - Bioengineering 2021Quote: ... the RNeasy Kit (Qiagen) was used according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNeasy mini kits (Qiagen) were used to purify the extracted RNA ...