Labshake search
Citations for Qiagen :
951 - 1000 of 3700 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was incubated for 1 hr with Ni-NTA agarose beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... using specific primers (Supplemental Table 1) in a Rotor-Gene Q machine (Qiagen). Standard curves were achieved by dilutions of one cDNA sample ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 1 ml of Ni-NTA agarose beads (Qiagen), equilibrated in the lysis buffer for 1 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... with zirconia/silica beads in 1 mL RLT buffer (Qiagen, Germantown, MD, USA). RNA was extracted using the Zymo Direct-zol RNA Miniprep Plus kit as recommended by the manufacturer ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was added to a 1-mL Ni-NTA agarose column (QIAGEN). The column-bound HigB2–HigA2 complex was disrupted by washing the column with buffer containing 5 M guanidine-HCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA from 1×106 cell was first extracted with RNeasy Plus kit (Qiagen), per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... lymphophilum API-1 were extracted using the QIAamp PowerFecal Pro DNA kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: A total of 1 x 106 cells were lysed using RLT buffer (QIAGEN) and total RNA was extracted using RNeasy isolation kit plus (QIAGEN ...
-
bioRxiv - Physiology 2024Quote: ... Frozen liver (∼20 mg) was homogenized in 1 mL of QIAzol (Qiagen 79306) and phase separated after the addition of 200 µL of chloroform ...
-
bioRxiv - Pathology 2024Quote: ... RNA was isolated from passage 1 fibroblasts using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted from 1×106 cells with the RNeasy Mini Kit (Qiagen). Reverse transcription was conducted using Superscript III (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... The supernatant was incubated with 1 ml of Ni-NTA agarose beads (Qiagen) pre-equilibrated in resuspension buffer for 1 hour at 4 °C with gentle rotation ...
-
bioRxiv - Immunology 2024Quote: Lungs were weighed and flash-frozen in 1 mL RNAprotect Tissue Reagent (Qiagen). For RNA isolation ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was isolated from INS-1 cells using RNeasy kit (Qiagen, Germantown, MD) and from islets using TRIzol reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... overnight and purified from a 1% agarose gel (QIAquick Gel Extraction Kit, Qiagen).
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA from cardiomyocytes was obtained on day 6 post adenovirus infection using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cortical neurons on 6 cm dishes using RNeasy Plus Mini Kit (QIAGEN, 74134) and reverse-transcribed using SuperScript II (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Microbiology 2022Quote: Amplification was carried out in a Rotor Gene thermocycler 6-plex with Quantitect Multiplex PCR kit (Qiagen) with 0,24μM of each primer y 0,25μM of each probe under the following conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from all samples (5 CTRL and 5 SCZ subjects at six timepoints across astrocyte differentiation) using either the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or the MagMax mirVana Total RNA Isolation Kit (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Microbiology 2024Quote: ... IFAS and LifeGuard Soil Preservation were transferred into a 5 mL bead beating tube from DNeasy PowerWater kits for 5-minutes of vortexing (Qiagen, Hilden, Germany). Afterwards ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...