Labshake search
Citations for Qiagen :
51 - 100 of 1029 citations for Synthetic Apoptosis Regulator Bcl 2 BCL2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Synthetic capped mRNAs were purified with the RNeasy Mini Kit (QIAGEN #74104).
-
bioRxiv - Neuroscience 2023Quote: ... synthetic RNA spike-ins (UniSp2, UniSp4, UniSp5 RNA Spike-in mix; Qiagen) were added and used as quality controls for RNA isolation ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Cell Biology 2020Quote: ... dNTPs and synthetic mRNA Spike-Ins contained in 5 μl of Vapor-Lock (Qiagen). Immediately following sorting ...
-
bioRxiv - Genomics 2021Quote: ... Resulting libraries of synthetic RNA spikes were cleaned up using RNeasy spin columns (Qiagen). Synthetic RNA integrity was confirmed by RNA Nano 6000 chip on the Agilent Bioanalyzer.
-
bioRxiv - Cancer Biology 2023Quote: ... BON1/TGL/pQ and BON1/TGL/HA-Bcl-xL) grown on 6-cm dishes were used to isolate mRNA using RNeasy Plus Mini kit (Qiagen, 74136) containing gDNA Eliminator spin columns ...
-
bioRxiv - Immunology 2023Quote: ... 25 nM and 50 nM of synthetic hsa-miR-30b or control mimics (50 nM) (Qiagen). At 36 h post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA expression of 84 apoptotic genes was analyzed using the RT2 Profilμer PCR Human Apoptosis Array (Qiagen, PAHS-012Z). Arrays were prepared according to the manufacturer’s protocols applied to the prepared cDNA samples ...
-
bioRxiv - Microbiology 2022Quote: ... Synthetic miRNA mimics (miRCURY LNA miRNA mimics) and LNAs (miRCURY LNA miRNA power inhibitors) were obtained from QIAGEN. Synthetic antagomir were obtained from Ribobio ...
-
bioRxiv - Cell Biology 2020Quote: Membranes were blocked in Blocking Solution (PentaHis Kit, Qiagen, #34460) for 1 h at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 25 fmol of the exogenous synthetic spike-in control Caenorhabditis elegans miRNA cel-miR-39 (Qiagen, Cat. No. 219610) was spiked into samples at the beginning of the extraction procedure to check both the extraction of miRNAs and the efficiency of the cDNA synthesis ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: For SYBR Green and Taqman PCR Serial dilutions of known standards were made using synthetic miR-122 (syn has-miR-122-5p, 219600, Qiagen). The dilutions were prepared in triplicate ...
-
bioRxiv - Neuroscience 2021Quote: ... We also performed the knock down using two different synthetic antisense LNA GapmeRs for Mili-KD or negative control (Mili 339511, Control 339515, Qiagen). Mili knock down was assessed by real time qPCR and Western Blot.
-
bioRxiv - Microbiology 2022Quote: ... The synthetic sglPP7 DNA was amplified using primers KC94 and KC116 and the resulting PCR product was gel purified (Qiagen), digested with restriction enzymes EcoRI and XhoI (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... We co-transfected 100 ng of psiCheck-23xant-miR275 and the synthetic tsetse miR275miScript miRNA mimic at 100 nM (Qiagen) or with AllStars Negative Control (Qiagen ...
-
bioRxiv - Genetics 2019Quote: RNA samples were prepared from multiple independent yeast cultures grown on synthetic complete medium using the RNeasy Mini Kit (Qiagen). Sequencing libraries were prepared using the TruSeq Stranded mRNA library method (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: RNA samples were prepared from multiple independent yeast cultures grown on synthetic complete medium using the RNeasy Mini Kit (Qiagen). Sequencing libraries were prepared using the TruSeq Stranded mRNA library method (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The expression of the BCL-2 anti-apoptotic genes in the NPC cell lines were accessed using the custom RT2 Human Apoptosis Profiler PCR array (Qiagen, Hilden, Germany). To delineate the contribution of MCL-1 for cell survival ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... The sample was incubated at room temperature for 5 min and 3.75μL (25 fmol final concentration) of the synthetic spike-in control Caenorhabditis elegans miRNA cel-miR-39 (Qiagen, Cat. No. 219610) was spiked into samples ...
-
bioRxiv - Immunology 2021Quote: ... and an undisclosed peptide pool inducing CD8+ T lymphocyte stimulation (Qiagen, 2017); rmsHBHA which tubes contain recombinant M ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transfected with 10 nM Malat1 ENE-targeting (ASO) or control (Con) steric blocking ASOs (Exiqon, Qiagen) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... with YFV-C (1-10) K8ac peptide were grown from a solution containing 0.1 M HEPES (pH 7.0) (QIAGEN), 30% PEG 6000 (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... with YFV-C (1-10) K4ac/K8ac peptide were grown from a solution containing 0.1 M HEPES (pH 7.0) (QIAGEN), 30% PEG 6000 (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: ... The target protein was eluted by 0.2 mg/ml FLAG peptide and load to Ni-NTA affinity gel (Qiagen). After washed by Lysis Buffer supplied with 0.02% GDN and 0.004% CHS ...
-
bioRxiv - Microbiology 2020Quote: ... Crystals of Brd4(BD1) with YFV-C (1-10) K4ac peptide were grown from a solution containing 0.2 M sodium chloride (QIAGEN), 0.1 M Tris (pH 7.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled ORC were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer B with 10 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled Cdt1 were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer D with 10 mM imidazole for 1.5 hr with rotation at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... Obtained fully tryptic peptides were mapped to the secalin and nsLTP sequences in CLC Genomics Workbench v12 (Qiagen, Aarhus, Denmark) using 100% sequence identity to confirm the expression at individual protein levels.
-
bioRxiv - Biochemistry 2022Quote: ... Membranes were blocked for 1 hour at room temperature either with a commercial blocking buffer (QIAGEN, anti RGS HIS6 HRP conjugate kit) or with 5% milk in 0.05% tween TBS buffer ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic DNA was extracted from the control and the peptide-treated frozen cells using the Blood & Cell Culture DNA Midi Kit according to manufacturer’s instructions (Qiagen, ref. no. 13343). A first PCR was performed to amplify the lentiCRISPR sgRNA region using the following primers:
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...