Labshake search
Citations for Qiagen :
51 - 100 of 1714 citations for Recombinant Human Chemokine C X C Motif Ligand 10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... Cells were rinsed at rested at 37°C for a minimum of 1h before undergoing red-blood-cell lysis by 5-10 ml RBC lysis solution (Qiagen) for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following complete removal and evaporation of residual ethanol (10 mins at 30°C) DNA was extracted using the AllPrep DNA/RNA FFPE Kit (Qiagen). DNA was eluted in 40 µl Elution buffer.
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCOs were stored at -80°C in RNAlater (Qiagen) until library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and further disrupted by TissueLyser II (QIAGEN, C.0659). 100 mg ground sample was first resuspended in 1 mL lysis buffer (1×PBS ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Bioengineering 2022Quote: ... after which the cells were FACS sorted for high and low reporter signal.The genomic DNA was extracted by lysing the cell pellets for 10 minutes at 56°C in AL buffer (Qiagen, 19075), supplemented with Proteinase K (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The relative expression of mRNAs of c-Myc regulated genes identified in RT2 Profiler™ PCR Array Human MYC Targets (Qiagen, Cat. no. PAHS-177Z) was determined by real-time quantitative RT-PCR ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was prepared from day one adult animals raised at 25°C or 20°C by using RNeasy® Mini Kit (Qiagen, Venlo, The Netherlands). endu-2(tm4977 ...
-
bioRxiv - Immunology 2020Quote: ... were either frozen at −80°C in RLT buffer (Qiagen) for future RNA extraction or snap frozen using O.C.T.™ and preserved at −80°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... after which the chemokine was purified using nickel-nitrilotriacetic acid (NTA) resin (Qiagen). Purified CCL5 was refolded by first adding 4mM DTT to the eluate at pH>7 ...
-
bioRxiv - Neuroscience 2021Quote: ... spun down (400 g × 10’ at 4 °C) and the pellet was resuspended in 600μ of Qiazol Lysis Reagent (Qiagen, Cat.No. 79306) and kept at −80 °C before sequencing.
-
bioRxiv - Evolutionary Biology 2019Quote: Total DNA was extracted from tadpole tails by overnight digestion in 10% proteinase K solution at 56 °C and extracted using the Qiagen Biosprint 96 DNA blood kit (Qiagen, CA, USA). DNA was eluted in 100 - 200 μL buffer AE (QIAgen).
-
bioRxiv - Immunology 2021Quote: ... Samples were centrifuged at 14,000 g at 4°C for 10 mins and the supernatant collected for processing using a RNeasy mini-isolation kit (Qiagen Ltd, UK) according to the manufacturers’ protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... 19 motifs and 4 differential motifs were analyzed to predict upstream regulators using Ingenuity Pathway Analysis (IPA, QIAGEN Inc.). Gene expression signatures indicative of HMO and motif abundance were defined as genes differentially expressed with abundance in the previous limma analysis(FDR q<0.05 and |Fold Change|>1.5).
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli C mutants was extracted using DNeasy Blood & Tissue kit (Qiagen). Quality of extracted DNA was confirmed before sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... This was incubated in a 37 °C shaker for 1 hour before the addition of Proteinase K (10 µl, QIAGEN, >600 mAU / ml) and left at 55 °C for 1 hour ...
-
Macrobdella decora: Old World Leech Gut Microbial Community Structure Conserved in a New World LeechbioRxiv - Microbiology 2019Quote: ... The supernatant was transferred to clean 1.5mL MCF tube and to which 350 μL ethanol at 4’C was added before vortexing for 10 sec and transferring the supernatant to a QIAamp Mini spin column (Qiagen Germantown, MD U.S.A.). The sample was process as recommended in the QIAamp DNA Mini Handbook and eluted with 10 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2020Quote: ... Enzyme was inactivated at 95 ° C for 10 min and 700 μl Trizol was added followed immediately by RNA extraction using the miRNeasy kit (Qiagen Inc., Valencia, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... overnight at 37 °C and purified by a PCR purification kit (Qiagen). Subsequently ...
-
bioRxiv - Neuroscience 2020Quote: ... at −80°C until RNA extraction using the RNeasy Mini Kit (Qiagen). RNA quality was determined using the RNA nano assay on a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7.5 at 4°C) and purified using the RNAeasy kit (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... RNA and protein were digested in 40 mM Tris-HCl pH 6 and 10 mM EDTA by adding first RNAse A (Qiagen; #19101, 1.5 hours, 37°C), followed by Proteinase K (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR arrays were performed using RT2 Profiler™ PCR Array Mouse Cytokines & Chemokines (PAMM-150Z, Qiagen). Calculations were performed by a comparative method (2−ΔΔCt ...
-
bioRxiv - Immunology 2021Quote: ... and kept at 4°C RNA was purified using RNEASY Mini Kit (Qiagen) and its concentration determined using a Nanodrop 1000 ...
-
bioRxiv - Systems Biology 2019Quote: ... and stored at −80°C for future RNA isolation (Qiagen cat. no. 74136). Total T cells were also sampled and processed as other cultures on the day of isolation (day 0 ...
-
bioRxiv - Neuroscience 2020Quote: ... at -80°C and RNA was extracted using RNeasy PLUS Micro kit (Qiagen). Microdissected tissue from 2 brains was pooled to make one replicate sample ...
-
bioRxiv - Microbiology 2021Quote: ... at 4°C until RNA was extracted using the RNeasy Mini Kit (Qiagen)
-
bioRxiv - Cell Biology 2022Quote: ... Islets were frozen at −80°C in 100 μL of RLT buffer (Qiagen) with beta mercaptoethanol (1%) ...
-
bioRxiv - Biochemistry 2019Quote: ... at 15 °C and purified by affinity chromatography on Ni-nitrilotriacetate resin (Qiagen) followed by TEV protease treatment to remove the tag ...
-
bioRxiv - Immunology 2021Quote: ... and stored at – 80 °C until processing using RNeasy Micro Plus kit (Qiagen) per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... froze them at –80°C and pulverized them using a TissueLyser II (Qiagen). We extracted DNA from the samples with DNAEasy Plant Mini Kit (Qiagen ...