Labshake search
Citations for Qiagen :
51 - 100 of 2034 citations for PD 1 Human C93S HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... the precipitates were subjected to Western blot analysis with anti-penta-His (1:2000, Qiagen) and anti-FLAG M2 (1:4000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Biochemistry 2023Quote: ... Cleaved CK1δ ΔC was further purified away from His-GST and His-TEV using Ni-NTA resin (Qiagen) and subsequent size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... the Penta-His HRP Conjugate Kit (Qiagen) was used following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... The Penta-His HRP Conjugate Kit (Qiagen) was used for detection of His-tagged proteins according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... the cells were washed once with 0.1% PBSA and incubated with 50 μL of a 1:100 dilution of anti-penta-His Alexa 647 antibody (Qiagen) for 10 minutes on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... Signal was detected using mouse anti-His antibody from Qiagen (Cat No./ID: 34660 1:500). Anti-mouse HRP was used for colorimetric development (Cat No./ID-A8924 1:1000) ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from plant cells and Hi-C libraries were prepared using EpiTect Hi-C Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant containing His-eIF4A1 or His-eIF4A2 was incubated with a 1.5 ml bed volume of Ni-NTA Superflow (Qiagen, 30430) or a 0.75 ml bed volume of Ni-NTA agarose (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... coli strains expressing (His)6-Clr4 and (His)6-Swi6 and allowed to bind at 4°C overnight to Ni-NTA resin (Qiagen; binding capacity 5-10mg protein/ml resin) ...
-
bioRxiv - Molecular Biology 2022Quote: Drosophila S2 cells were transiently transfected with pAc-brm-FLAG-6xHIS in combination with either pAc-clk-V5-HIS or pAc-V5-HIS empty plasmid using Effectene (Qiagen). For cycloheximide experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transiently transfected with pAc-brm-FLAG-6xHIS in combination with pAc-clk-V5-HIS or pAc-V5-HIS empty plasmid using Effectene (Qiagen). Cells were harvested 48 hours after transfection for processing ...
-
bioRxiv - Biophysics 2023Quote: ... Cleaved PCNA was separated from His-SUMO and uncleaved His-SUMO-PCNA by incubating the protein solution with 5 ml Ni-NTA suspension (Qiagen) resuspended in solution D on a tilting table for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The primary antibodies were used at the following dilutions: 1:1000 anti-penta-His mouse monoclonal (Qiagen), 1:5000 anti-cMyc mouse monoclonal (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was mixed with 1 ml of 50% Ni2+-NTA His-bind resin (Qiagen, Hilden, Germany), incubated for 1 hr at 4°C with mild rotatory shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... and with a mouse antibody against the His-tag (Tetra·His Antibody, QIAGEN-Cat. No.34670, 1:2,000) in blocking solution on a rocker ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... conjugated with anti-penta-his biotin antibody (Qiagen) for 1 and half hours at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... were inserted Bam HI site of pET30a (Qiagen) to produce pET30a-YFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies included: anti-Penta-His (QIAGEN, #34650), anti-FLAG M2 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a Penta His HRP conjugate was used (Qiagen). A Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Bioengineering 2023Quote: ... before his-tag purification with Ni-NTA (QIAGEN) and wash and elution buffers of the same composition as the solubilization buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 µl Hi-Perfect transfection reagent (Qiagen, 301707), and 1 µl of the desired (20 µM ...
-
bioRxiv - Neuroscience 2024Quote: ... 7.5 µl Hi-Perfect transfection reagent (Qiagen, 301707), 1.25 µl siRNA stock (20 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µl Hi-PerFect Transfection Reagent (Qiagen; #301705) and 60 µl of siRNA mixture (1 µM ...
-
bioRxiv - Biophysics 2024Quote: ... or anti-His6X (His HRP conjugate by Qiagen) antibodies at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2024Quote: The HEK293 stable cell lines were generate by a transfection with Effectene (Qiagen) and 1µg plasmid (pmCherry-N1-hERG-WT and -A561V ...
-
bioRxiv - Molecular Biology 2023Quote: ... 40% of the protein material of each fraction was analyzed by Western blot using an anti-his antibody (Penta-His antibody, Qiagen #34660). Detection was performed with a secondary antibody conjugated with horseradish peroxidase (Anti-Mouse IgG Peroxidase antibody ...
-
bioRxiv - Cell Biology 2021Quote: Antibodies and their conditions of use are as follows: mouse anti-His (Western blot, 1:1000; 34660; Qiagen), rabbit anti-Brl1 (Western blot ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Cancer Biology 2019Quote: ... His-tagged proteins were purified on NiNTA beads (Qiagen). Purified proteins were eluted with 500 mM NaCl ...
-
bioRxiv - Genetics 2019Quote: ... or anti-tetra His (0.1 μg/ml Qiagen 34670) were used as primary antibodies ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His is a peroxidase-conjugated antibody (Qiagen). The membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... PABPC1-His was bound to Ni-NTA resin (Qiagen), washed by 1x PBS (10 mM imidazole added ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...