Labshake search
Citations for Qiagen :
51 - 100 of 1495 citations for Mouse Anti Canine Parvovirus 2 Antibody 3G3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated with biotinylated anti-5His antibodies (Qiagen) and stored for up to 6 months with continuous rotation at 4°C in BRB80 (80 mM Pipes ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse monoclonal antibody that recognizes the strep-tag epitope was purchased from Qiagen. Recombinant NifB expressed in E ...
-
bioRxiv - Cell Biology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His is a peroxidase-conjugated antibody (Qiagen). The membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The anti-His antibody conjugated to horseradish peroxidase (Qiagen) was used at a dilution of 1:5,000 ...
-
bioRxiv - Immunology 2022Quote: ... then incubated with the primary antibody anti-His (Qiagen) at a concentration of 1:2500 in a solution of 3% non-fat milk in TBS-T overnight at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Anti-Penta-His antibody was purchased from Qiagen (Germany).
-
bioRxiv - Biophysics 2023Quote: ... The antibodies were anti-RGSHis (Qiagen, Cat. No. 34650) and peroxidase-conjugated anti-mouse antibody (Dako ...
-
bioRxiv - Biochemistry 2022Quote: ... an anti GAPDH monoclonal antibody (SC-47724) or an anti RGS HIS6 HRP (QIAGEN). When necessary ...
-
bioRxiv - Biochemistry 2023Quote: ... and mouse anti-Phospho-Serine Q5 (catalogue number: 37430) was from Qiagen. Horseradish peroxidase-conjugated secondary antibodies against rabbit (catalogue number ...
-
bioRxiv - Cell Biology 2021Quote: ... were functionalized with biotinylated anti-5His antibodies (Qiagen, Valencia CA) and stored with continuous rotation at 4°C in BRB80 (80 mM PIPES ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: anti-STrEP-Tag (#34850, Qiagen), monoclonal anti-β-actin antibody (A5441 ...
-
bioRxiv - Biophysics 2019Quote: ... and probed with primary antibodies anti-5His monoclonal (1:1,000; QIAGEN), anti-Myc monoclonal (1:1,000 ...
-
bioRxiv - Biophysics 2020Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used.
-
bioRxiv - Biochemistry 2022Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used ...
-
bioRxiv - Biophysics 2022Quote: The following anti-His fluorophore-conjugated antibodies were purchased from Qiagen and used in UV-Bind assays for His-tagged proteins ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound PEX5L was detected immunologically using monoclonal Anti-His Antibodies (Qiagen).
-
bioRxiv - Neuroscience 2022Quote: RNA was isolated from snap frozen striatal mouse tissue from 2 independent cohorts of mice according to the manufacturer’s protocol and purified using RNeasy columns (Qiagen). A total of 13 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Biophysics 2020Quote: ... functionalized with neutravidin and treated with biotinylated anti-hexahistidine monoclonal antibody (Qiagen) as described (15) ...
-
bioRxiv - Biochemistry 2021Quote: ... The primary and secondary antibodies used were anti-penta His (Qiagen #34660) and goat anti-mouse IgG (LiCOR #926-68070 ...
-
bioRxiv - Biochemistry 2021Quote: ... resuspended in 100 μL PBS containing 0.1 μg anti-penta·His antibody (Qiagen) and 1 μg streptavidin allophycocyanin (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Immunology 2022Quote: ... the DNA was extracted from 100 mg mouse fecal samples (9-week-old, 2 weeks after final oral gavage treatment) using QIAamp PowerFecal Pro DNA kit (Qiagen) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Immunology 2021Quote: ... 150 ng DNA per reaction was amplified in duplicate using primers and probes specific to γHV68 Orf50 and mouse Ptger2 (see table) and 2× QuantiNova Probe Mastermix (Qiagen). Standard curves were obtained by serial dilutions of Orf50 and Ptger2 gBlocks (ORF50 ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were washed with PBS-T (PBS1x/0.1% Tween 20) and incubated with mouse antibody against 6xHis-tag (1:2,000; Qiagen), rabbit antibody against GST-tag (1:10,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... Chambers were washed with BRB80 and then were coated with mouse antibody against 6xHis-tag (1:50; Qiagen) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2 expression or SARS-CoV-2 nucleocapsid (N) gene in individual mouse organs was determined using QuantiNova SYBR Green PCR kit (Qiagen #208052) in combination of 500 nM of hACE2 gene specific primer set (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 40% of the protein material of each fraction was analyzed by Western blot using an anti-his antibody (Penta-His antibody, Qiagen #34660). Detection was performed with a secondary antibody conjugated with horseradish peroxidase (Anti-Mouse IgG Peroxidase antibody ...
-
bioRxiv - Biochemistry 2020Quote: ... and protein expression was analyzed by immunoblotting using monoclonal anti-RGSH4 antibodies (Qiagen) to detect ABCG5 and polyclonal anti-hABCG8 antibodies (Novus Biologicals ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted and purified from 20 mg (2 pellets) of stool from each mouse using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, MD). The concentration of DNA in samples was determined by spectrophotometry ...
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... stored at −20° C and characterized by immnoblotting using mouse anti-2xStrep tag (Qiagen #34850, 1:1,000), and secondary goat anti-mouse IgG IRDye® 800CW (LI-COR # 926-32210 ...
-
bioRxiv - Biochemistry 2022Quote: ... we also probed for the Strep-tag on γTuNA (1:1000 dilution of Strep-tag mouse monoclonal antibody, cat. # 34850, Qiagen). Band intensities were measured in ImageJ and normalized in Prism 7 by the wildtype γTuNA band (positive control) ...
-
bioRxiv - Microbiology 2023Quote: ... Pulled-down fractions were analysed by SDS-PAGE or Western blot using rabbit antibodies against KtrB or mouse against His-tag (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged DmMIC10b was detected using an anti-His antibody (Qiagen N.V., Venlo, The Netherlands, 34660).
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins transferred to a nitrocellulose membrane were probed with a monoclonal anti-His6 antibody (Qiagen, Germantown, Maryland). Detection of proteins via Western blotting was performed by fluorescence detection using IR-Dye®-labeled fluorescent secondary antibodies and imaged using the Odyssey CLx Imager (LICOR Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)