Labshake search
Citations for Qiagen :
51 - 100 of 10000+ citations for Human Eukaryotic Translation Termination Factor 1 ETF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Microbiology 2023Quote: Microbiome DNAs were extracted from the human samples on the same day of collection using the microbiome-specific kit (QIAamp DNA Microbiome Kit; Qiagen, Hilden, Germany). The DNA extraction was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA from human cancer cells was extracted 48h post transfection using the RNeasy Kit from Qiagen according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated from murine and human monocytes with the RNeasy Plus Micro Kit (Qiagen), and then 200 ng of RNA was reverse transcribed using the iScript RT Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured human and mouse cells using an RNeasy Mini Kit (Qiagen) and included an on-column DNase treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Microbiology 2021Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human FLMs and adjacent normal tissue was performed using the AllPrep DNA/RNA Mini Kit (Qiagen). Whole exome sequencing was performed by Novogene using their standard protocols ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Physiology 2023Quote: ... and grown to confluency and transfected with human Leptin constructs using Effectene kit (Cat# 301427, QIAGEN).
-
bioRxiv - Cancer Biology 2023Quote: gDNA was isolated from human sarcoma models and controls using the QIAamp DNA Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from human primary immune cells using the RNeasy Plus Micro Kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from human sarcoma models and controls using the RNeasy Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cancer Biology 2022Quote: A ready-to-transduce transcription factor-responsive lentiviral reporter system (CCS-1022L, QIAGEN) was used to generate a stable cell line ...
-
bioRxiv - Bioengineering 2021Quote: Genomic DNA from human primary CD4+/CD8+ T cells was isolated using the Gentra Puregene Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA (gDNA) from human blood cells was isolated using the QIAamp Blood kit (QIAGEN, Hilden, Germany). To isolate gDNA from different mouse tissues we made use of the blackPREP Rodent Tail DNA Kit (Analytik Jena ...
-
bioRxiv - Cancer Biology 2020Quote: Total genomic DNAs (containing human and viral genomes) were isolated using AllPrep DNA/RNA Mini Kit (Qiagen) from the NPC biopsy ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from human and murine PC cells were isolated using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Genomic human DNA was isolated from whole blood using QIAamp DNA Blood Mini Kit from Qiagen (51106) and phosphodiester DNA from TIB Molbiol ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Genetics 2019Quote: RNA was extracted from PCYT1A-wild-type human fibroblasts using the RNeasy Mini Kit (Qiagen, Cat#74104), reverse-transcribed according to the manufacturer’s protocol (SuperScriptIII One-Step RT-PCR system with Platinum Taq DNA Polymerase;Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA of human macrophages was isolated according to manufacturer’s instructions using the RNeasy extraction kit (Qiagen). mRNA was extracted using the Next Poly(A ...
-
bioRxiv - Cell Biology 2023Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using the RNeasy extraction kit (Qiagen). Two µg of RNA each was reverse transcribed with the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: Genomic DNA was purified from human peripheral blood mononuclear cells (PBMCs) using QIAamp kits (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA from 1205Lu cells and immortalized human melanocytes were isolated and purified using RNeasy Micro Kit (Qiagen) according to manufacturer’s instruction and concentration was quantified using a NanoDrop Spectrophotometer (ThermoScientific) ...
-
bioRxiv - Genomics 2024Quote: ... the effect of human rRNA removal was also assessed using a QIAseq FastSelect rRNA removal kit (Qiagen). The rRNA removal reaction was performed after RNA thermal denaturation at 95℃ 5 min according to the instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen, Hilden, Germany) or TRIzol reagent (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2024Quote: The RNA quality of human kidney FFPE sample was checked by RNeasy FFPE kit (Qiagen-Cat #73504) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...