Labshake search
Citations for Qiagen :
51 - 100 of 10000+ citations for Glutathione Colorimetric Detection Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was extracted directly from the plates using RNeasy Mini Kit (Qiagen, 74104). 2μg of RNA were used for cDNA synthesis using High Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific ...
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... Two hundred fifty microliters of each sample were transferred into 96-well PowerBead Plates (Qiagen, 27500-4-EP-BP). Seven hundred fifty microliters of RLT buffer from an AllPrep DNA/RNA 96 Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Free GST and thrombin were removed with a second glutathione column and a Ni-NTA column (Qiagen 30210) to remove thrombin ...
-
bioRxiv - Plant Biology 2020Quote: The real-time quantification of cDNA corresponding to 2µg of total RNA was performed in the ABI PRISM 7900HT sequence detection system using the QuantiTech SYBR Green RT-PCR kit (Qiagen). The Gene-specific primers used are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Viral RNA was extracted one from (Used in detection limit evaluation) using viral RNeasy® Mini-kit (Qiagen, Hildan, Germany). Extracted RNA was stored at −70°C until further use.
-
bioRxiv - Cancer Biology 2022Quote: ... paraffin-embedded (FFPE) 4 × 4 μm tissue sections of primary tumors and matched brain metastases using RNeasy FFPE kit (Qiagen, Hilden, Germany) per manufacturers’ instructions ...
-
bioRxiv - Immunology 2021Quote: ... and kept at 4°C RNA was purified using RNEASY Mini Kit (Qiagen) and its concentration determined using a Nanodrop 1000 ...
-
bioRxiv - Microbiology 2021Quote: ... at 4°C until RNA was extracted using the RNeasy Mini Kit (Qiagen)
-
bioRxiv - Microbiology 2020Quote: The MoBio PowerSoil-htp 96 kit (now Qiagen Cat No./Id: 12955-4), with minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of room temperature Stop solution (REPLI-g Single Cell Kit, Qiagen) was then added and the samples were vortexed and spun down ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 18 µl of Omniscript enzyme at 4 U/µl (Omniscript RT Kit, Qiagen), and 37 µl water ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Systems Biology 2019Quote: ... Plates were prepared using the miRCURY SYBR Green PCR Kit (Qiagen, cat. no. 339346) with custom miRCURY LNA PCR primers (Qiagen cat ...
-
bioRxiv - Immunology 2020Quote: ... DNA was extracted using the Qiagen MagAttract Power Microbiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) and used for rRNA sequencing and Helicobacter spp ...
-
bioRxiv - Molecular Biology 2020Quote: ... was purified from curd stomach milk collected from P7 offspring that were exposed to mCHD (n=4) or mHFD (n=4) using a combination of QIAzol and miRNeasy Mini Kit (217004; Qiagen, Toronto, ON, CA) as described previously (Izumi et al. ...
-
bioRxiv - Bioengineering 2021Quote: DNA contents in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Physiology 2023Quote: DNA content in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Complexes were pulled down using Glutathione-Sepharose 4B resin (Cytiva; 17-0756-01) or Ni-NTA resin (QIAGEN; 30210) for 2 h at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... 50 nuclei were sorted into each well of 4 twin.tec™ 96 Well LoBind PCR Plates that had 5 uL of EB buffer (Qiagen, 19086), 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C until DNA preparation using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacture’s recommendation ...
-
bioRxiv - Microbiology 2022Quote: ... the Qiagen MagAttract PowerSoil DNA Isolation Kit (Cat#: 27000-4-KF; Qiagen, Carlsbad, CA), against five other extraction kits ...
-
bioRxiv - Microbiology 2019Quote: DNA isolation was performed using the MagAttract PowerSoil DNA Kit (Qiagen, # 27100-4-EP) on Eppendorf epMotion 5075 liquid handlers following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and purified with the MiniElute PCR purification kit (QIAGEN, Cat. No. / ID: 28006×4). The purified genomic DNA fragments were end-repaired and had an A-tail added to the 3’ end ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Biophysics 2023Quote: ... for 4 h at 37 °C and purified with RNeasy Mini Kit (Qiagen; #74104). Following the in vitro transcription ...
-
bioRxiv - Genomics 2019Quote: ... Plates grown in parallel were used for genomic DNA extraction (DNeasy Blood & Tissue kit, Qiagen), and RNA extraction (TRIzol ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: The GST fusion proteins were expressed in bacteria (E. coli, BL21) and purified by glutathione-Sepharose (Cat No. 27-4574-01, Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Resultant cDNAs were used as template for qPCR and qPCR was performed on an Applied Biosystems 7900HT Sequence Detection system using a Sybr Green Quantitect kit (QIAGEN, Hildesheim, Germany). Quantification cycle (Cq ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Physiology 2021Quote: Total RNA was purified from embryos at 4 dpf using an RNeasy micro kit (Qiagen) with DNase I ...
-
bioRxiv - Neuroscience 2022Quote: ... we used 4 columns to purify product following the MinElute PCR Purification Kit manual (Qiagen). DNA from each column was eluate using 25 μL EB buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... 4 µg of the total RNA was treated with a GeneRead rRNA Depletion kit (Qiagen) and then with an RNeasy MiniElute kit (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: Total plants RNA were extracted from 4 weeks plants using the RNeasy kit (Qiagen, Germany) and two micrograms of RNA was reverse-transcribed using SuperScript IVTM Reverse Transcriptase according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned with the UltraClean 96 PCR Cleanup kit (Qiagen, Cat. #12596-4) and pooled using the same volume for each sample ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or from whole fecal pellets using a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4). Library preparation and sequencing was performed at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Genomics 2022Quote: ... The 12 wells from individual plate rows were pooled and cleaned (QIAquick PCR Purification Kit, QIAGEN), and the 30μl elutions resulting from every prep were combined and vortexed thoroughly ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were transfected using Effectene transfection kit for individual dishes or 24 well plates (Qiagen) or Linear PEI (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Colonies were scraped off the plates and plasmids were extracted with a plasmid maxiprep kit (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...