Labshake search
Citations for Qiagen :
51 - 100 of 644 citations for Alpha Actinin 4 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 20 mM imidazole and the recombinant V0c was purified over Ni-NTA beads (QIAGEN).
-
bioRxiv - Microbiology 2023Quote: ... The recombinant plasmid was purified using QIAgen mini prep kit (cat no.27106, Qiagen) as per manufacture’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant plasmids were extracted by using the EndoFree Plasmid Maxi Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: RNA FISH was performed using a FITC-labeled DNA oligo probe complementary to alpha satellite (Integrated DNA Technologies, Newark, NJ) or a biotinylated locked nucleic acid (LNA) oligo probe complementary to HSATII (QIAGEN, Hilden, Germany) (see Key Resources Table) ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Plant Biology 2022Quote: ... and the recombinant protein was purified on Ni-NTA agarose following the manfacturer’s instructions (Qiagen). The eluate (3x 500 μl ...
-
bioRxiv - Immunology 2020Quote: ... The linearized recombinant gDNA was transfected into 293 cells using the PolyFect Transfection Reagent (Qiagen). After virus rescue was observed via plaque formation ...
-
bioRxiv - Microbiology 2019Quote: ... The recombinant Lsr2 proteins were purified using immobilized-metal affinity chromatography (Ni-NTA agarose, Qiagen) and size exclusion chromatography ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Recombinant Fab proteins were purified from the culture supernatant by nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant mAbs were affinity purified by MabSelect resin (Cytiva ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All recombinant DNA was isolated and purified through Miniprep kits according to manufacturer’s instructions (Qiagen). Sequences were confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Synthetic Biology 2021Quote: 6His-tagged Mdb1 recombinant protein was expressed in BL21 and purified using Ni-NTA beads (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid was extracted from the positive transformant using Qiagen® Plasmid Mini (Qiagen, USA) and sequenced (Advanced Innovative Trusted Products & Solutions ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant proteins were purified on Ni-NTA columns (1 ml Ni-NTA Agarose; Qiagen Cat # 30210), washed with 20 ml hexokinase buffer (20 mM HEPES ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified using the His-tag Protein Purification Kit (Ni-NTA Agarose, QIAGEN GmbH), GST-tag Protein Purification Kit (Glutathione Sepharose ...
-
bioRxiv - Immunology 2019Quote: His-tag purified recombinant proteins were expressed in E.coli and purified by Ni+-NTA-agarose column (Qiagen). Then ...
-
bioRxiv - Cancer Biology 2020Quote: ... The recombinant plasmid pENTR-CTDSP1 was extracted from positive colonies using the QIAprep Spin Miniprep Kit (Qiagen) and proper orientation of the cloned fragment was verified by PCR and DNA sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... The polyhistidine-tagged recombinant proteins were then purified from bacterial lysates with Ni2+-NTA agarose beads (QIAGEN) and washed by three different washing buffers (Washing buffer 1 contained 20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids were extracted from cell pellets using the QIAprep Spin Miniprep kit (Qiagen, Valencia, CA, USA). The sequence of the inserts was confirmed by Sanger sequencing (W ...
-
bioRxiv - Plant Biology 2023Quote: ... The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN, Cat. No. 30210) according to the product protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... with 0.2% (m/v) arabinose and the recombinant protein was affinity purified using Ni-NTA agarose (Qiagen). For GST-CPK3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Molecular Biology 2020Quote: Purified recombinant poly-histidine protein was obtained by FPLC under native conditions using a Ni-NTA column (Qiagen), and a Biologic DUO-FLOW BIO-RAD chromatography system (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Preparation of hexahistidine-tagged recombinant DCP1 was performed according to the manufacturer’s instructions in Tris buffer (Qiagen, 30210). The abundance of proteins was estimated by CBB staining by SDS-PAGE or on immunoblots using anti-his antibodies ...
-
bioRxiv - Microbiology 2021Quote: The recombinant plasmid DNA derived from positive clones was isolated by using the QIAGEN plasmid mini kit (QIAGEN) and digested by PmlI (vector PFLD ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant proteins NHis6-Fnr1 and Fnr3-CHis6 in the supernatant were purified on Ni2-NTA resin (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... filtered and the secreted recombinant proteins were purified by affinity chromatography using Ni-NTA resin (Qiagen; Cat.# 30230). Specifically ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were collected by centrifugation and the recombinant protein was column-purified using Ni2+-NTA resin (Qiagen). The purified protein was stored at -80°C ...
-
bioRxiv - Microbiology 2023Quote: ... second and 10th passage in ECE of recombinant NDV_GRABV using the QIAamp® Viral RNA Mini Kit (Qiagen). Genomic regions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The agarose gel bound with the His-tagged recombinant protein was packed in the chromatography column (Qiagen, Germany), and the flow through was discarded ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant protein was purified with agarose beads that bind specifically to the His-tag (Ni-NTA Agarose, Qiagen) following the purification hybrid method from the ProBond purification system (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... and the recombinant protein was purified by gravity-flow chromatography using a nickel-charged resin Ni-NTA Agarose (QIAgen) equilibrated with 10 mM imidazole in the lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were lysed and recombinant proteins were purified under native conditions using the Ni-NTA Fast Start Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The pulldown protocol was based on the principle of immobilization of recombinant protein using Ni-NTA agarose resin (Qiagen). The experiments were performed in biological triplicates and designed to contain 4 control samples (resin Ni-NTA with i ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant plasmids for mouse vaccination were prepared using an EndoFree Plasmid Purification Kit (Cat# 12391, Qiagen, Hilden, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... All recombinant vectors were grown in XL1-Blue competent cells and extracted using QIAprep Spin Miniprep kit (Qiagen, Germany) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant proteins were purified to near homogeneity (>95%) using Ni-chelate affinity chromatography on Ni-NTA Superflow resin (Qiagen) using standard protocols ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...