Labshake search
Citations for Qiagen :
51 - 100 of 3767 citations for 6H Pyrrolo 1 2 1 2 imidazo 4 5 f 2 1 3 benzoxadiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and centrifuged to clarify the supernatant ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and were then centrifuged to clarify the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of sample culture was immediately transferred into 2 mL RNA protect bacteria (QIAGEN) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was extracted from 1 – 2 x 108 cells using the RNeasy kit (Qiagen). DNA was removed using Turbo DNase (Applichem ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR 2 products were purified by 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), eluting with 15 μL of Elution Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were homogenized in a mixture of chloroform and methanol (2:1) using TissueLyser II (Qiagen) and dried in a Vacufuge (Eppendorf ...
-
bioRxiv - Immunology 2021Quote: DNA from 1-2 stool pellets was extracted using the QIAamp DNA Stool Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures samples were then mixed 1:2 with RNA Protect Bacteria Reagent (QIAGEN, Germantown, Maryland, USA), vortexed immediately for 5 seconds and incubated for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were then treated with DpnI for 1-2 hr and then purified (QiaQuick, Qiagen) before use in library construction.
-
bioRxiv - Microbiology 2023Quote: ... each spot was collected into a 1:2 mix of LBS and RNAprotect Bacteria reagent (Qiagen), incubated at RT for 5 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... About 1 OD/mL cells were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, 76506), and the cell pellet was collected by centrifuging at 2500 g for 8 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl diluted cDNA (1:20) were added to SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and 10 μM of both forward and reverse primer (Primer Sequences Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were homogenized for 2 × 1 min at 30 Hz using a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until further processing.
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were homogenized (2 x 1 min at 30 Hz) by a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until next step ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Genetics 2021Quote: ... PCR 2 products were purified by electrophoresis with a 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen) and eluting with 30 μL water ...
-
bioRxiv - Systems Biology 2019Quote: ... ∼20 mg frozen tissue was pulverised in chloroform-methanol (400 µl; 2:1 v/v) using a TissueLyser (Qiagen), then the mixture was sonicated for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2022Quote: ... PCR#1 amplicons were selected on a 2% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen). These amplicons were then used as template for “PCR#2” reactions ...
-
bioRxiv - Physiology 2022Quote: Frozen liver tissue was manually crushed and 30 mg per sample was homogenized in 1mL of 2:1 chloroform:methanol via a TissueLyser II (Qiagen). Samples were stored at 4 °C overnight with agitation ...
-
bioRxiv - Cancer Biology 2019Quote: ... tissue was digested away from the slide by incubating the tissue with 1% 2-mercaptoethanol in RLT buffer (Qiagen) for one hour at 56°C with interval shaking ...
-
bioRxiv - Cancer Biology 2020Quote: ... tissue was digested away from the slide by incubating the tissue with 1% 2-mercaptoethanol in RLT buffer (Qiagen) for one hour at 56°C with interval shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor, 2.5 μM template switch oligo with Qiagen #339414YCO0076714 ...