Labshake search
Citations for Qiagen :
51 - 100 of 1714 citations for 6 CHLORO 9 3 2 CHLOROETHYLAMINO PROPYLAMINO 2 METHOXYACRIDINE DIHYDROCHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9-10 mL of Buffer BB (1/3 of the lysate volume, From QIAGEN Plasmid Plus Midi Kit) was added ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Plant Biology 2020Quote: Genomic DNA was isolated from all Arabidopsis genotypes at 6 and 9 days after inoculation using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany).
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid DNA was extracted from 3-9 positive colonies where possible after blue-white screening using a QIAprep® Spin Miniprep Kit (Qiagen) and sequenced using the standard T7 primer at Eurofins Genomics ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Neuroscience 2020Quote: ... and miR-9/9*-124 + shPTBP2 using TRIzol Reagent in combination with RNeasy mini kit (Qiagen, 74104). RNA quality (RIN > 9.6 ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...