Labshake search
Citations for Qiagen :
51 - 100 of 1767 citations for 6 7 Dichloro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... 5’ and 3’ untranslated regions and open reading frames) for the paralogs were made using the CLC Main workbench 7 (QIAGEN® Aarhus A/S, Aarhus C, Denmark). Sequence alignments were generated for the genomic DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Pathology 2021Quote: ... Let-7 miRNA primers were purchased from QIAGEN.
-
FGF signalling is involved in cumulus migration in the common house spider Parasteatoda tepidariorumbioRxiv - Developmental Biology 2021Quote: CLC Main Workbench 7 (QIAGEN Aarhus A/S) was used to perform a local tBLASTn [25] against the Parasteatoda tepidariorum official AUGUSTUS gene set (https://i5k.nal.usda.gov/Parasteatoda_tepidariorum ...
-
bioRxiv - Microbiology 2022Quote: ... 100ng of RNA was converted to cDNA for 1h at 37 °C using the Omniscript RT kit (Qiagen) and random primers (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2021Quote: ... All were designed using CLC Genomics Workbench 7 (Qiagen) and synthesized by Eurofins Genomics (http://www.eurofins.com) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 7 µL of PolyFect transfection reagent (QIAGEN, Duesseldorf, Germany) was added ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from 18 ONS cell samples (6 AD patients, 6 MCI and 6 HC) were extracted using Allprep universal kit (Qiagen cat. no. 80224). RNA-seq libraries were prepared using the Illumina TruSeq Stranded Total RNA library Prep Gold Kit (Illumina 20020598 ...
-
bioRxiv - Systems Biology 2020Quote: ... 6×10^6 PBMC from each sample were transferred directly to Quiazol regent (QIAGEN), resuspended and immediately aliquoted and stored at −80°C until RNAseq downstream processing ...
-
bioRxiv - Plant Biology 2021Quote: ... the protein was removed by 1.1 μL of proteinase K (20mg/ml) at 45° C for 1h and RNA by 2μL of RNaseA (1mg/ml) (Qiagen) digestion at 37°C for 1h ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Evolutionary Biology 2021Quote: ... One million cells per well were seeded in 6 well plates in 2 mL growth medium the day before transfection and transfected with PolyFect (Qiagen, Düsseldorf, DE) using the manufacturers protocol (changing the medium to growth medium without hygromycin B and puromycin prior to transfection) ...
-
bioRxiv - Molecular Biology 2020Quote: 6 ml Ni-NTA (QIAGEN) was washed with 5 column volumes of wash buffer 1 (150 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Cells were rinsed at rested at 37°C for a minimum of 1h before undergoing red-blood-cell lysis by 5-10 ml RBC lysis solution (Qiagen) for 20 min at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 and 15 days and purified using RNeasy kit (Qiagen). 1 μg of RNA per condition was used to retrotranscribe into cDNA QuantiTect® Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA was extracted from fresh leaves of 2 to 3-week-old seedlings for all lines using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was collected 7 days post-TGFB1 treatment (RNAeasy Kit, Qiagen). cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... IDT) in a tube containing 7 μL Vapor-Lock (Qiagen, 981611) to prevent evaporation ...
-
bioRxiv - Genomics 2023Quote: ... The 600 cell pellets (1e+7) were prepared with RNAprotect (Qiagen) and stored at -80°C until shipment on dry ice ...