Labshake search
Citations for Qiagen :
51 - 100 of 3765 citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA was extracted from fresh leaves of 2 to 3-week-old seedlings for all lines using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cancer Biology 2021Quote: ... a 19-mer SPRY2 target sequence (5′-AACACCAATGAGTACACAGAG-3) (QIAGEN) was used and for the control a 19-mer NSi control sequence (QIAGEN ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...