Labshake search
Citations for Qiagen :
51 - 100 of 2131 citations for 5 2 Chloronicotinoyl 2 furoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2022Quote: L cell monolayers were disrupted by scraping and pelleted at 200 x g for 5 min before RNA was isolated from 2 x 105 cells using the RNeasy Plus Mini RNA extraction kit (Qiagen) per manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... of 0.2-0.3 was pelleted by centrifugation at 7000 x g for 5 minutes and pellets were resuspended in 1mL of ATGN media and incubated with 2 mL of RNAProtect reagent (QIAgen) for 15 min at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2021Quote: ... up to 200 mg of tissue was disrupted in TRIzol (Lifetechnologies) with 2 x 5 mm stainless steel beads using the TissueLyser (Qiagen) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... up to 200 mg of tissue was disrupted in TRIzol (Lifetechnologies) with 2 x 5 mm stainless steel beads using the TissueLyser (Qiagen) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and proteins were extracted from fresh or snap-frozen FACS-sorted 2-5 million splenic B cells using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Immunology 2024Quote: ... slides from 25 epidemic KS and 2 endemic KS tumor biopsies and 5 samples of uninvolved skin using the AllPrep DNA/RNA FFPE Kit (QIAGEN). Gene expression analysis was performed on RNA samples on the Nanostring platform (Nanostring Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... The fresh leaf discs were transferred to a 2 mL tube containing a 5 mm stainless steel bead and 500 µL buffer RLT (QIAGEN). The leaf discs were disrupted using a TissueLyser LT (QIAGEN ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was extracted from 2 mm root tips of 5 DAG seedlings using the RNeasy Plus Micro Kit (cat. No. 74034 QIAGEN). Prior to cDNA synthesis ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Physiology 2024Quote: ... was mechanically homogenised in TRI reagent with a 5 mm steel bead at 30 Hz for 2 x 30 s (TissueLyser II, Qiagen) then centrifuged for 10 min at 10,000 g ...
-
bioRxiv - Synthetic Biology 2024Quote: ... two small lab spoons (5 mm) of biomass were transferred to a 2 mL screw cap tube with a steel bead inside (5 mm; Qiagen) and frozen using liquid nitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... Eluted complex was then mixed to 6 μL of 5 M NaCl and 2 μL of 100 mg/mL RNase A (Qiagen) and incubated overnight at 65°C to reverse cross-linking and digest RNA ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Bioengineering 2024Quote: ... posterior eye cups (PECs) were separated and collected in 2 mL reinforced tubes (SPEX Sample Prep) containing 5 mM stainless steel beads (Qiagen, LLC).
-
bioRxiv - Evolutionary Biology 2023Quote: Tissue pools were homogenised for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen, Germany). A volume of 0.2× chloroform (Carl Roth ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was applied to a 5 ml nickel-nitrilotriacetic acid column (Qiagen, Valencia, CA) that had been equilibrated with buffer A at a rate of 1 ml/min ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...