Labshake search
Citations for Qiagen :
51 - 100 of 2190 citations for 2 5 Dimethyl 3' morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were reverse transfected with 5 pmol of each siRNA (QIAGEN) using lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Neuroscience 2024Quote: ... for 3 minutes with a 5 mm stainless steel ball (Qiagen, Cat. No. 69989). RNA was isolated using the Qiagen RNeasy Lipid Tissue Extraction Kit (Qiagen ...
-
bioRxiv - Bioengineering 2024Quote: ... CHMP6 (Hs_CHMP6_1) target sequence: 5′-CTG AGC GCA ATC ACT CAG GAA -3′ (QIAGEN Sciences LLC ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was briefly incubated (approximately 5 min) with 3 ml Ni-NTA Agarose (QIAGEN) before flow-through was collected ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN), subcloned into a pTAC-2 Vector (Bio Dynamics Laboratory lnc. ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml sterile 1X PBS to produce internal fly-bacterial suspensions.
-
bioRxiv - Microbiology 2024Quote: 3-5 × 105 cells were harvested and total RNA was extracted using the RNeasy kit (Qiagen) employing on-column DNase treatment ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated 2 hr with 5 mL of packed Ni-NTA agarose beads (Qiagen), filtered (0.45 µm Millex-HP PES membrane filter unit ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...