Labshake search
Citations for Qiagen :
9651 - 9700 of 10000+ citations for Mouse Activation Induced Cytidine Deaminase AICDA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG) ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA was reverse transcribed using the Omniscript RT kit (Qiagen), and the resulting DNA was amplified with the HotStarTaq DNA Polymerase (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from the strains using the DNeasy kit (Qiagen), re-transformed into E ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... was extracted and purified on columns (Qiagen RNeasy Plus Micro kit) and consequently was subjected to mRNA isolation ...
-
bioRxiv - Neuroscience 2022Quote: ... and total RNA was isolated using RNeasy MinElute Cleanup Kit (Qiagen). mRNA was enriched by poly-A capturing and RNA-seq libraries were generated using KAPA mRNA HyperPrep Kit (KAPA Biosystems).Libraries were sequenced using the Illumina HiSeq 1500 platform.
-
bioRxiv - Immunology 2022Quote: RNA was extracted from podocytes using the RNeasyPlus Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and total cellular RNA was purified using the RNeasy kit (Qiagen). cDNA was synthesized from the purified RNA by both random and oligo(dT ...
-
bioRxiv - Cancer Biology 2022Quote: ... ShRNA plasmids were purified with QIAprep Spin Miniprep Kit (#27106, Qiagen) after overnight incubation with E-coli bacteria ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were purified using the QIAquick PCR purification Kit (Qiagen).
-
bioRxiv - Cancer Biology 2022Quote: ... except that the Blood and Cell Culture DNA Mini Kit (QIAGEN) was used instead of the suggested kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which total RNA was isolated using RNEasy mini kits (Qiagen) and treated with RNase-free DNase (Qiagen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA isolation was done by using the miRNeasy micro Kit (Qiagen). RNA quality analysis was done by using Qubit and Bioanalyzer at the NGS High Throughput genomics core ...
-
bioRxiv - Genomics 2022Quote: ... albopictus using Qiagen DNeasy® Blood & Tissue Kits (Qiagen, Hilden, Germany). Extracted DNA was used to build double digest restriction-site associated DNA (ddRAD ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was prepared using miRNeasy mini kit (Qiagen-cat no 217004). Reverse transcription was carried out using SuperScript III First-strand Synthesis System (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated using a RNeasy Plus Mini Kit (Qiagen). BGI performed the library preparation and sequencing with 50BP SE sequencing ...
-
bioRxiv - Genetics 2022Quote: ... Gel extraction was performed using QIAquick Gel Extraction Kit (Qiagen #28704), according to the manufacturer guidelines ...
-
bioRxiv - Immunology 2022Quote: ... The RNA was further purified using the RNeasy Micro Kit (Qiagen), DNase treated ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was extracted with the RNeasy Plus mini kit (Qiagen) and sequenced on the NovaSeq 6000 (PE 20million reads) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total RNA was extracted using a RNeasy Plant Mini kit (QIAGEN), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... reverse crosslinked and purified with the MinElute PCR purification kit (Qiagen). The DNA fragments were prepared with the KAPA HTP Library Preparation Kit (Roche ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from livers by using the RNeasy kit (Qiagen). cDNA was synthesized from 1 μg RNA by using the OneScript® Plus cDNA Synthesis Kit (Applied Biological Materials Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the amplified plasmids were extracted by a Plasmid Maxi Kit (QIAGEN) to a concentration of approximately 2 μg/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid preparations were performed using a Plasmid Max Kit (Qiagen #12165). The Zhx2 expression plasmid was described previously.7
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA was prepared using an RNeasy RNA mini kit (Qiagen). Four micrograms of total RNA were used were prepared cDNAs using M-MLV reverse transcriptase ...
-
bioRxiv - Molecular Biology 2022Quote: ... the reaction was cleaned using the MinElute PCR purification kit (Qiagen), and a PCR with 10-13 cycles was performed using the NEBNext High Fidelity 2X PCR Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... purified by agarose gel extraction (MinElute Gel Extraction Kit, Qiagen #28606) and pooled together ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA extraction was performed using the RNeasy Mini Extraction kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: Total RNA was extracted using the RNeasy Mini kit (Qiagen, 74104) and 1 µg of total RNA was reverse-transcribed using the High-Capacity RNA-to-cDNA kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR reactions were purified with QIAquick PCR Purification Kit (Qiagen, 28106) and quantified with nanodrop ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA plasmids were isolated using QIAprep Turbo Miniprep Kit (Qiagen, 27191). gRNA sequences were confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen) and amplification of sgRNA inserts was performed via PCR using barcoded primers for each condition ...
-
bioRxiv - Cancer Biology 2022Quote: ... Genomic DNA extracted using the QIAmp DNA Blood Maxi Kit (Qiagen). Genomic DNA samples were amplified ...
-
bioRxiv - Biochemistry 2022Quote: ... RNA was collected and isolated with the QiAshredder kit (Qiagen, 79656) followed by RNeasy™ Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: RNA from cultured cells was isolated using RNeasy Mini Kit (Qiagen). Gene expression was quantified using One-Step qRT-PCR Kits (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was prepped using Qiagen HiSpeed Plasmid Maxi Kit (Qiagen #12662). Zebrafish were then electroporated with a BTX ECM 830 machine (BTX #45-0662 Holliston ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was extracted from lysates using an RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was extracted from lysates using an RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from cell pellets using the RNeasy Kit (Qiagen), and library preparation and sequencing was performed by the Duke Sequencing and Genomic Technologies Shared Resource ...
-
bioRxiv - Biophysics 2022Quote: ... RNA extraction was done using the Qiagen RNeasy kit (Qiagen, #75144) following the provided protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... followed by extraction with a Qiagen plant RNA mini kit (Qiagen). Subsequent RNA sequencing work was carried out by the Next Generation Sequencing Facility (Leeds Institute of Biomedical & Clinical Sci.) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR products were purified with the QIAquick PCR Purification Kit (Qiagen) and eluted in 10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: mRNA was extracted using the RNeasy kit (Qiagen, Valencia, CA, USA). RNA was reverse-transcribed to cDNA using SuperScript® IV FirstStrand Synthesis SuperMix following the manufacturer’s instructions (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... The amplified sequences were purified using QIAquick PCR Purification kit (Qiagen) and eluted in nuclease-free water.
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was extracted from cells using an RNeasy kit (Qiagen).
-
bioRxiv - Biophysics 2022Quote: ... each DNA sample was purified using MinElute PCR Kit (Qiagen, 28004) and eluted in 30 µL of Buffer EB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The products were gel purified using QIAquick PCR Purification Kit (Qiagen) and sent for sanger sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... cRNAs were purified using the RNeasy Mini Kit (QIAGEN Ref. 74104), centrifuged at 4°C and microinjected into prophase I arrested oocytes with a FemtoJet microinjector (Eppendorf) ...
-
bioRxiv - Cell Biology 2022Quote: Following DNA extraction using Qiagen’s All Prep kit (Qiagen catalogue # 80284) standard methods ...
-
bioRxiv - Developmental Biology 2022Quote: ... and RNA isolation was performed using the miRNeasy micro kit (Qiagen) according to the manufacturer’s instructions ...