Labshake search
Citations for Qiagen :
9501 - 9550 of 10000+ citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... purified with the use of a QIAquick Gel Extraction Kit (Qiagen), and sequenced ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was purified from the lysate using RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was isolated by RNeasy Micro or RNeasy Mini kits (Qiagen) followed by cDNA synthesis using the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific).
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was extracted using the RNeasy mini kit buffers (Qiagen) and purified on RNA-binding spin columns (Epoch) ...
-
bioRxiv - Microbiology 2019Quote: ... ChIPed DNA was purified using a PCR clean up kit (Qiagen). For input samples (an aliquot of the sonicated ...
-
bioRxiv - Physiology 2019Quote: ... and RNA samples were purified using the miRNeasy kit (#1038703, Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using random and HAstV1-specific reverse primers ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA transcripts were purified using the RNeasy mini kit (QIAGEN), eluted with RNAse-free sterile water and stored at −80°C prior to use.
-
bioRxiv - Developmental Biology 2019Quote: ... RNA was extracted from individual samples using RNAeasy Micro Kit (QIAGEN). For RNA-seq ...
-
bioRxiv - Developmental Biology 2019Quote: ... The two supernatants were combined and purified with MinElute kit (Qiagen) in 22µl of EB buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... DNA was isolated from blastocysts using the QIAamp Investigator Kit (Qiagen), eluting in 23 uL of nuclease-free water ...
-
bioRxiv - Neuroscience 2019Quote: ... Complementary DNA was synthesized by using the Omniscript RT Kit (Qiagen) or SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... and RNA extraction (TRIzol, ThermoFisher Scientific and RNeasy mini kit, Qiagen).
-
bioRxiv - Immunology 2019Quote: RNA from sorted cells was extracted using RNeasy micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse transcription was performed using the Quantitect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... and cleaned using the QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany). Samples were sent to Eurofins Genomics (Eurofins Genomics Co. ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from embryos using RNeasy Mini Kit (Qiagen), and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Microbiology 2019Quote: ... and were then treated with the RNeasy MinElute Cleanup Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... Mitochondria isolation was performed using the Qproteome Mitochondria isolation kit (Qiagen). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA over 200 nt was first isolated using RNeasy kit (Qiagen). Subsequently ...
-
bioRxiv - Immunology 2019Quote: ... Total RNA was extracted by column purification (Qiagen RNeasy Mini Kit). RNA was sent to the Vincent J ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... whole genome amplification was performed using REPLI-g Mini kit (Qiagen) due to the low concentrations of gDNA ...
-
bioRxiv - Bioengineering 2019Quote: ... genomic DNA was extracted using DNAeasy Blood and tissue kit (Qiagen). To tested if translocation created chimeric chromosomes containing both CRISPR LiveFISH labeled Chr3 and Chr13 loci ...
-
bioRxiv - Biochemistry 2021Quote: Mammalian cells: RNA was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... All post-reaction purifications utilized the MinElute PCR Purification Kit (Qiagen).
-
bioRxiv - Pathology 2021Quote: ... using QuantiTect SYBR Green RT-PCR Kit and QuantiTect Primers (Qiagen). Three housekeeping gene mRNAs (GAPDH ...
-
bioRxiv - Genomics 2021Quote: ... and cleaned up with the RNeasy Mini Kit (Qiagen, Venlo, Netherlands). Accumulibacter clade quantification was performed on biomass samples collected on the same day of the metatranscriptomics experiment using clade-specific ppk1 qPCR primers as described by Camejo et al ...
-
bioRxiv - Genomics 2019Quote: ... The final library was purified using a Qiagen MinElute kit (Qiagen) and Ampure XP beads (Ampure ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using a Puregene Tissue Core Kit B (Qiagen).
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using a QIAquick PCR Purification Kit (Qiagen) and each gene was inserted into an entry vector (pDONR222 ...
-
bioRxiv - Genetics 2020Quote: ... verified by sequencing and purified with a Plasmid Midi kit (Qiagen).
-
bioRxiv - Genetics 2020Quote: ... The eluted DNA was purified with MinElute PCR purification kit (Qiagen) and analyzed by qPCR or NovaSeq (150bp paired-end ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and the NEXTFLEXTM Rapid DNA-seq Kit (NOVA-5114-03 and NOVA-5144-04 ...
-
bioRxiv - Immunology 2021Quote: RNA from cells was obtained using the RNA Easy Kit (Qiagen) incorporating the DNAse I step to remove contaminating genomic DNA ...
-
bioRxiv - Genomics 2021Quote: ... then total RNA was extracted with RNeasy Mini Kit (Qiagen, Tokyo) (n=6 for control and treated respectively) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated using the miRNeasy mini kit (Qiagen #217004) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid DNA was isolated using QIAprep Spin Miniprep Kits (Qiagen, 27106).
-
bioRxiv - Genetics 2020Quote: DNA was extracted using the Qiaprep Spin Miniprep kit (Qiagen, #27106) combined with an in-house yeast lysis protocol ...
-
bioRxiv - Microbiology 2021Quote: RNA was harvested from cells using RNAeasy RNA extraction kit (Qiagen) as per manufactures instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA extraction were performed using DNEasy Qiagen kit (Qiagen, Valencia, USA). All PCR reactions were performed at 25µl total with 12.5 ul 2X Promega Hot Start Master Mix (Promega Corporation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted using a RNeasy Mini kit (Qiagen, China), and mRNA subsequently enriched using immobilized oligo(dT) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We isolated total RNAs with the RNeasy Plant Mini kit (Qiagen) from 100 mg of infected leaf tissues including a DNaseI (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... we used the QIAamp Viral RNA kit following manufactures recommendations (Qiagen). For reverse transcription and synthesis of complementary DNA the Omniscript RT Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We purified these products using a QIAquick PCR purification kit (QIAGEN). For the few samples that contained large amounts of primer dimers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and sequenced in both directions using the aforementioned primers ...
-
bioRxiv - Genomics 2020Quote: ... RNA was isolated from cell pellets using the RNEasy kit (Qiagen) and converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... and reverse transcription using a QuantiTet Reverse Transcription kit (205311; QIAGEN). Relative quantification of genomic DNA or cDNA was performed on a 7900HT Fast Real-Time PCR System (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: RNAs were extracted using the RNeasy Mini Kit (Qiagen, Cat. #: 74104) from midturbinate swabs collected in the study that resulted in lowest Ct in the TAC assays for influenza A (Subject ID #239 ...