Labshake search
Citations for Qiagen :
901 - 950 of 3415 citations for OF 1 CAS 919973 83 4 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Plant Biology 2024Quote: ... 3-4 plants were pooled and RNA was extracted using the RNeasy plant mini kit (Qiagen). 100 ng of total RNA per sample determined using a Qubit fluorometer (Thermofisher) ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA extractions were performed with the MagAttract PowerSoil DNA kit (Qiagen, Cat. No. 27000-4-KF) optimized for the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from about 2-4×106 cells using the RNeasy Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) or the E.Z.N.A Total RNA kit I (Omega-Biotek) ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatant was incubated for 2 h at 4°C while rotating with Glutathione superflow beads (Qiagen) for GST-tagged CMK-1 variants or nickel-nitrilotriacetic acid beads (Ni-NTA ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 4-day-old Arabidopsis seedlings using RNeasy Plant Mini Kit (Qiagen). For cDNA synthesis ...
-
bioRxiv - Biochemistry 2024Quote: ... for 4 h at 37 °C and purified with PCR purification kit (QIAGEN, catalog no. 28106) per 20 μL IVT reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted from 4×107 cells using a Puregene Cell Kit (Qiagen Cat#158043). Lentiviral sgRNA inserts were amplified in a two-step PCR using the primers detailed in Supplementary Table 6 ...
-
bioRxiv - Genetics 2024Quote: ... eluted in 4 µl of scPBS and processed following the REPLI-g SC kit (Qiagen, Germany) manufacturer’s guidelines with an incubation time of 2h ...
-
bioRxiv - Cell Biology 2020Quote: ... The resulting solution was transferred to a QIA shredder spin column (Qiagen Inc., Valencia, CA, USA) and centrifuged at 15,000 rpm for 2 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by purification of the aqueous layer using a RNeasy Micro Kit (Qiagen Sciences, Valencia, CA). A modified Kapa Biosystems (Wilmington ...
-
bioRxiv - Genetics 2021Quote: ... we extracted DNA from the secondary substrates using the QIAamp DNA Investigator Kit (QIAGEN, Valencia, CA). The procedure from the QIAamp DNA Investigator Handbook for the Isolation of Total DNA from Body Fluid Stains was selected as it has a denim option to remove any inhibitors ...
-
bioRxiv - Genetics 2021Quote: ... the first wave was collected from buccal swabs using the Qiagen Autopure method (Qiagen, Valencia, CA). In 2008 ...
-
bioRxiv - Microbiology 2020Quote: ... Viral DNA and RNA were extracted with the QIAamp MiniElute Virus Spin Kit (QIAGEN, Chatsworth, CA) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... All the expression plasmids were purified using the EndoFree plasmid purification kit from Qiagen (Valencia, CA).
-
bioRxiv - Microbiology 2021Quote: DNA extraction for all assessed compartments was performed using the DNeasy PowerSoil kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Extracted DNA was quality and quantity screened using a QIAxpert microfluidics electrophoresis device (Qiagen, Valencia CA).
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from spinal cords using RNeasy® Plus Mini Kit (QIAGEN, Valencia, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction was performed in a Rotor-Gene 600 thermocycler (Corbett Research, Qiagen Inc., Valencia, CA) at 64°C for 50 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and genomic DNA was extracted using the Qiagen DNeasy Blood Tissue Kit (QIAGEN, Valencia, CA, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified using a MinElute 96 UF PCR Purification Kit (Qiagen, Valencia, CA, USA). Libraries were sequenced (2 x 300 bases ...
-
bioRxiv - Genomics 2020Quote: ... De novo genome assembly was performed using CLC Genomics Workbench 11 (QIAGEN Bioinformatics, Redwood City, CA). Depth of coverage ranges between 17X-608X (Supplemental Table S4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Triplicates of every sample were transferred by a pipetting robot (Corbett CAS-1200, Qiagen, Hilden, Germany) to Rotor-Gene strip reaction tubes (Starlab ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was isolated from plant tissues using RNeasy Plant RNA isolation kit (Qiagen, Valencia, CA). 1µg of total RNA was used for cDNA synthesis using Verso cDNA synthesis kit (Thermo Fisher Scientific Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNAs were purified from transposition sample by using Min-Elute PCR purification kit (Qiagen, Valencia, CA) and measured by Qubit ...
-
bioRxiv - Plant Biology 2020Quote: ... Pooled eluates were transferred together with 1.2 mL of Ni-NTA resin (Qiagen, Valencia, CA, USA) into a 15 mL Falcon tube and incubated for 2 h at 4°C with gentle rotation ...
-
bioRxiv - Plant Biology 2021Quote: ... and genomic DNA was extracted using a DNeasy® Plant Mini kit (QIAGEN Inc., Valencia, CA), following the manufacturers protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The fungal DNA was extracted with a DNeasy Plant Mini Kit (Qiagen Inc. Valencia, CA, USA), amplified with Fusarium Tri5 DNA PCR primers TMT_fw (5’-GATTGAGCAGTACAACTTTGG-3’ ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA was purified from supernatants using the QIAamp Viral RNA Mini kit (Qiagen, Valencia, CA), the concentration determined with a Spectronic BioMate*3 UV spectrophotometer (Thermo Scientific ...