Labshake search
Citations for Qiagen :
901 - 950 of 10000+ citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and aged (n=10) RVLM-containing tissue punches was reverse transcribed to cDNA using an RT2 preamp cDNA synthesis kit (Qiagen, Inc., First strand cDNA synthesis) following manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2022Quote: ... 333µl Protein Precipitation Solution (Qiagen) was added and samples were vortexed vigorously for 20 seconds at high speed ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein Precipitation Solution (Qiagen #158910), DNA Hydration Solution (Qiagen #158914 ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from cells treated for 48 h with 1 mM aspirin and 4 μM regorafenib using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen Cat# 80004) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were lysed in the plate using 1 mL of RTL buffer from an AllPrep DNA/RNA/Protein isolation kit (Qiagen, Hilden, Germany). Experiments were performed in triplicate.
-
bioRxiv - Immunology 2023Quote: Total DNA and mRNA were isolated from the intestine samples collected during fish necropsy with the AllPrep DNA/RNA/Protein Kit (Qiagen, Hilden, Germany), following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Samples were then centrifuged and plasma isolated and stored at -20°C prior to testing in the QuantiFERON IFNγ ELISA (Qiagen). Acceptance criteria for the assay specified by manufacturers were always met.
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Plant Biology 2019Quote: ... 50,000 protoplasts in a volume of 100 μL were transformed with 20 μg of each plasmid (2 μg/μL) purified using the Plasmid Maxi kit (Qiagen, Germany). One batch of protoplasts was treated with an equivalent amount of water and used as the negative (untransformed ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted using enzymatic lysis and mechanical disruption of the cells and purified with the RNeasy mini kit (Protocol 2, Qiagen, USA). The RNA standard (25ng ...
-
bioRxiv - Genomics 2021Quote: ... The samples were then transferred to RNeasy spin columns and 2 ml collection tubes from an RNeasy Mini Kit (Qiagen, 74104) and centrifuged at 13,000 rpm for 15 sec ...
-
bioRxiv - Genomics 2022Quote: Buccal swab samples were placed in 2 mL Eppendorf tubes and were extracted using a modified version of the DNeasy® Blood and Tissue Kit (Qiagen). In each tube were added 380 μL of ATL Buffer and 20 μL of Proteinase K (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from a minimum of 2 × 106 sorted MDSCs or nonMDSCs using an RNAeasy Mini Kit (Qiagen, Germantown, MD). RNA sequencing was performed by GENEWIZ (South Palinfield ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from 2 g of homogenized material from frozen needles using the DNeasy Plant Maxi Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... MCMBP depleted cells using siRNA and MCMBP-KO (clone #1 and #2) cells was isolated using RNeasy Mini Kit (Qiagen, 74104). The cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: Isolated Chromatin was digested with 1% proteinase K for 2 hrs at 60 °C with 300 rpm and was subsequently purified by using QIAquick® Nucleotide Removal Kit (28306, Qiagen) according to the manufactory’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... log-phase cells in the range of 1–2 × 108 cells using the Qiagen DNeasy® Blood and Tissue kit (Qiagen). We resuspended the genomic DNA in 10 mM Tris-HCl pH 8.5 and stored it at 4° until submission to the McDonnell Genome Institute at Washington University in St ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 viriants S and point-mutated pseudovirus were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN, Cat#52906), and served as template for reverse transcription using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR reagent (TransGen Biotech ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was subsequently generated using 2 μg of total RNA and the miScript II Reverse Transcription (RT) Kit (Qiagen, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μg of RNA was used to generate cDNA using the RT2 First Strand Kit (#330401, SABiosciences, a Qiagen Company). In a fluorescent temperature cycler ...
-
bioRxiv - Immunology 2022Quote: The total RNA was extracted from uninfected and SARS-CoV-2 infected mice lung tissue using RNeasy mini kit (QIAGEN #74104). The quantity of RNA was determined using Qubit RNA assay kit with Qubit 4.0 and the quality of RNA was tested using agarose gel electrophoresis and High Sensitivity Tape station Kit (Agilent 2200 ...
-
bioRxiv - Neuroscience 2023Quote: ... After protein digestion (PK Buffer and Proteinase K (20 mg/mL) for 2 hrs at 45°C) DNA was purified with QIAquick PCR Purification Kit (Qiagen, Germany) according to manufacturer instruction ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA fragment of interest was excised from a 2% agarose gel and purified with QIAquick Gel Extraction Kit (Qiagen Inc.). The NEBNext Ultra DNA Library Prep Kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was extracted from NCI-PC35-1 and NCI-PC35-2 organoids using an AllPrep DNA/RNA Mini Kit (Qiagen 80204) according to the manufacturer’s protocol for animal cells ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA thus obtained was diluted to 2 ng/µl and specific target miRNAs were amplified by qPCR using the miRCURY LNA SYBR Green PCR kit (Qiagen, 339346). Expression of all targets was normalised against the expression of two reference genes (SNORD48 and U6 ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted from each 2 g of bulk and rhizosphere soils of the pepper plants using a RNeasy PowerSoil Total RNA Kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cancer Biology 2022Quote: ... and protein extraction were performed according to manufacturer instructions (AllPrep DNA/RNA/Protein minikit; Qiagen). Each spin column flowthrough (DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...
-
bioRxiv - Neuroscience 2022Quote: PCR with forward and reverse primers (see Table 1) was performed on mouse hypothalamic cDNA (isolated with miRNeasy Mini Kit, Qiagen, Hilden, Germany). PCR products were ligated into pGEMT.easy (Promega ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA and miRNA fractions were isolated from the mouse frozen tissue with the miRNeasy Micro Kit protocol (Qiagen, Toronto, ON, Canada). All RNA samples were determined to have 260/280 and 260/230 values ≥1.8 ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: DNA was isolated from tail biopsies using the Gentra Puregene Mouse Tail Kit according to the manufacturer’s instructions (Qiagen, Valenica, CA, USA). Genomic DNA was digested with BamHI-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2019Quote: ... Total RNA and miRNA fractions were isolated from the mouse frozen tissue with the miRNeasy Micro Kit protocol (Qiagen, Toronto, ON, Canada). All RNA samples were determined to have 260/280 and 260/230 values ≥1.8 ...
-
bioRxiv - Microbiology 2021Quote: ... Total genomic DNA was extracted from each ked lysate and blood (camel, mouse, and rabbit) using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from the tail tip of a wild-type C57BL/6J mouse using the DNEasy Blood and Tissue Kit (Qiagen, Hilden, Germany). The genomic C-terminal region of OGT was amplified using the Q5 Hot Start High Fidelity 2x master mix (New England Biolabs) ...