Labshake search
Citations for Qiagen :
8951 - 9000 of 10000+ citations for Rat Palmitoyl Protein Thioesterase 1 PPT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Genomic DNA of cells co-transfected with a plasmid expressing sgRNA and another expressing SpCas9 was isolated and purified through a commercially available kit (Qiagen, QIAamp DNA Mini Kit Cat# 51304) as per the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... nerve chain and ovaries of each female was extracted using standard protocols (DNA used for ONT sequencing: Macherey-Nagel NucleoBond HMW DNA kit, DNA used for Illumina sequencing: Qiagen DNeasy 96 Blood & Tissue kit). The long-read sequencing library was prepared using the SQK-LSK109 Ligation Sequencing Kit (ONT ...
-
bioRxiv - Plant Biology 2020Quote: ... The resulting DNA was purified using QIAquick PCR Purification Kit (Qiagen). DNA was quantified with a LightCycler 480 (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated using RNeasy Plant Mini Kit (QIAGEN, Catalog # 74904) and subjected to RNase-free DNase I (Life Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...
-
bioRxiv - Plant Biology 2020Quote: ... The resulting amplicons were gel purified (MinElute Gel Extraction Kit, QIAGEN) and assembled by Gibson assembly (see Figure S1 for detailed map) ...
-
bioRxiv - Microbiology 2020Quote: ... extracted from the gel using the QIAquick Gel Extraction kit (Qiagen), and Sanger sequenced by Genewiz ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from homogenized tissue using a DNeasy kit (Qiagen) according to the manufacturer’s instructions followed by treatment with RNAse I (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were purified by using the Qiaprep spin miniprep kit (Qiagen).
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen). The Takara Prime ScriptTM RT Master Mix (Takara Bio Inc. ...
-
bioRxiv - Plant Biology 2020Quote: ... Total DNA was extracted using a DNeasy Plant Mini Kit (Qiagen). For the quantification of gene expression levels during pathogen infection ...
-
bioRxiv - Plant Biology 2020Quote: ... and cleaned up using a RNeasy Mini Kit (Qiagen, Hilden, Germany) including on-column DNase treatment using a RNase-free DNase kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... The total RNA was extracted using the RNeasy Mini Kit (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... total RNA was isolated using the RNeasy plant mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA was purified with a RNeasy MiniElute cleanup kit (Qiagen) according to the manufacturer’s instructions and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR products were purified with MinElute PCR Purification Kit (Qiagen). Bulk RT-PCR products were cloned into the barcoded cloning vector and sequenced using the Illumina MiSeq machine ...
-
bioRxiv - Synthetic Biology 2021Quote: All Plasmids were purified using the Midiprep kit (QIAGEN or Promega)
-
bioRxiv - Synthetic Biology 2021Quote: ... before being purified using a Qiaquick PCR purification kit (Qiagen, #28104).
-
bioRxiv - Biophysics 2021Quote: gDNA was isolated using the DNeasy Blood & Tissue Kit (Qiagen #60506) and the target region was amplified via PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen). Libraries were prepared by nested PCR method as described previously 49 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was extracted from cells using the RNeasy mini kit (Qiagen). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... using the IndiMag® Pathogen Kit (QIAGEN® GmbH, Hilden, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was isolated using a RNeasy Plus Mini Kit (Qiagen). BGI performed the library preparation and sequencing at 50 base pair (BP ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by extraction using the RNeasy Mini Kit (Qiagen, Hilden Germany). RNA (1 µg ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was extracted from miRNeasy kit from Qiagen (cat. No. 217004) and mRNA-seq was performed as described before [96].
-
bioRxiv - Neuroscience 2021Quote: ... DNA was purified and eluted using MinElute PCR purification kit (Qiagen). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA extraction was performed immediately thereafter using RNAeasy Kit (Qiagen, 74104) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was extracted with the RNeasy mini kit (Qiagen, 74106) plus on-column DNAse I digestion (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated using the RNeasy mini kit (Qiagen, # 74104). Following RNA isolation ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated using the RNeasy Plus Mini kit (74134, Qiagen) and sent to the Weill Cornell Medicine Genomics Core facility ...
-
bioRxiv - Cancer Biology 2021Quote: ... The total RNA was extracted using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from the cells using RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was first extracted using Qiagen RNEasy kits (Qiagen, Hilden, Germany). cDNA was then created from the RNA samples using an iScript kit (BioRad ...
-
bioRxiv - Genomics 2021Quote: ... and DNA was purified with QIAquick PCR purification kit (QIAGEN 28106). ChIP-seq libraries were constructed using the Illumina’s TruSeq ChIP sample preparation kit (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was then isolated using the RNeasy mini kit (Qiagen, 74104). Expression data were generated using Affymetrix Clariom S arrays.
-
bioRxiv - Cancer Biology 2021Quote: ... and the RNeasy PowerLyzer Tissue & Cells Kit (Qiagen, CAT # 15055-50) was used to extract RNA from peripheral blood mononuclear cells (PBMCs ...
-
bioRxiv - Microbiology 2020Quote: ... and then total RNA was extracted using a RNeasy kit (Qiagen). Genomic DNA was removed using the Turbo DNA-free kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA extraction was completed using RNEasy mini kit (Qiagen, 74106) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Total cellular RNA was extracted using an RNeasy mini kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Total DNA was prepared using DNeasy Blood and Tissue Kit (Qiagen). Validated primers for Mitochondrial (CCCATTCCACTTCTGATTACC ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted using the DNeasy Blood and Tissue kit (QIAGEN); quality and concentration were verified using a UV-Vis spectrophotometer (Thermo Scientific NanoDrop One) ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: Total RNA was purified by using RNeasy mini kit (Qiagen #74104) by following the company's instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Precipitated DNA samples were purified by QIAquick PCR purification kit (Qiagen) and quantified by Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was extracted from cell pellets (DNeasy Blood & Tissue Kit, Qiagen) and stored at −80°C until completion of screens ...
-
Chromatin accessibility changes at intergenic regions associates with ovarian cancer drug resistancebioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from cells using the Gentra PureGene kit (Qiagen). 1μg purified DNA was sheared using Bioruptor Pico (Diagenode ...
-
bioRxiv - Cell Biology 2020Quote: RNA samples were extracted using the RNeasy Mini kit (Qiagen, 74104), and the quality of total RNA was assessed by the 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: After RNA extraction using the RNeasy Micro or Mini Kit (QIAGEN), quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA from spleen was digested overnight with DNeasy extraction kit (Qiagen) for further downstream qPCR analysis.
-
bioRxiv - Cell Biology 2020Quote: ... RNA was isolated using the RNeasy RNA purification mini kit (QIAGEN) or GeneJET RNA purification kit (Thermo Fisher (according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated with the DNeasy Blood & Tissue kit (Qiagen) according to manufacturer’s instructions ...