Labshake search
Citations for Qiagen :
851 - 900 of 10000+ citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Samples were then centrifuged and plasma isolated and stored at -20°C prior to testing in the QuantiFERON IFNγ ELISA (Qiagen). Acceptance criteria for the assay specified by manufacturers were always met.
-
bioRxiv - Physiology 2022Quote: ... Using the Neuronal ion channel plate (Qiagen, UK), 84 ion channels as well as housekeepers were measured in each sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and released into a PyroMark Q24 plate (Qiagen) pre-loaded with 0.3μM of sequencing primer ...
-
bioRxiv - Genetics 2023Quote: ... plates were shaken on a TissueLyser II (Qiagen) at 900 rpm (15 rps ...
-
bioRxiv - Microbiology 2019Quote: ... Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen, NSW, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... and sunflower_KTI _R (5’ – CTACTCAGATTGAACAGAAGCCAC- 3’were designed and used in a PCR reaction with total DNA extracted (DNeasy Plant Mini Kit, Qiagen, Valencia CA USA) from sunflower leaf tissue ...
-
bioRxiv - Microbiology 2021Quote: ... Intact bacterial cells were pelleted by centrifugation at 10,000 x g for 5 min at room temp and DNA extracted from the pellet using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). DNA concentration was assessed by the QubitTM dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... we pooled 1.5 mg RNA from each sample (mixed-stage, male-enriched, and starved) and used the RNeasy MinElute Cleanup kit (Qiagen, catalog no. 74204) to further purify and concentrate the pooled RNA ...
-
bioRxiv - Immunology 2022Quote: ... Cells were centrifuged for 5 minutes at 300xg and pellets resuspended in Buffer RLT Plus (RNeasy Plus Mini Kit from Qiagen, Germantown, MD, USA), and frozen at −80°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was extracted from 5 to 10 million cells or 15 to 25 mg of tissue using the MagAttract HMW DNA kit (Qiagen N.V., Venlo, Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: PON2 level was quantified in the mouse whole brain homogenate in 100 mg per 1 ml of QIAzol® lysis reagent (Qiagen, Hilden, Germany). mRNA 500 ng was used for cDNA synthesis in 10 μl volume according to the manufacturer’s instructions of PrimeScriptTM RT-PCR kit (Takara Bio Inc. ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was isolated from whole brain tissue from 3 biological replicates per strain for 45 strains of the HRDP using QIAzol (Qiagen, Valencia, CA, USA). The brain was split sagitally and half of the brain was used for RNA sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μL of Ni-NTA (Qiagen) slurry was added and the solution was incubated with light agitation at 4 °C for 50 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL 10X PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Genetics 2022Quote: ... 5 μl of each sample was pooled into one of 5 indexed libraries and PCR purified using a QIAquick PCR Purification Kit (Qiagen, Inc., Valencia, CA, USA). Prior to preparing individuals for next generation sequencing ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with 5 µl proteinase K (20 mg/ml) and lysed overnight at 56°C under shaking in Cell Lysis Solution (Qiagen Gentra Puregen Cell kit) with proteinase K (20 mg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Microbiology 2019Quote: ... with two sets of 96-well adapter plates (QIAGEN) containing 2 ml microcentrifuge tubes (QIAGEN ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was loaded with a QIAgility Robot (Qiagen) and run on 7500 Fast Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... EasyXtal 15-well Tool crystal plates (Qiagen, Manchester, UK) were set up manually for HAdV-D15 ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Genomics 2022Quote: An aliquot of 150 μL of plasma per sample was thawed on ice and centrifuged at 3000 × g for 5 min at 4 °C and smallRNA was extracted using miRNeasy Serum/Plasma Kits (Qiagen, Cat. No. 217184, Milano, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...