Labshake search
Citations for Qiagen :
851 - 900 of 2631 citations for 8 1 Methoxyethoxy 2 6 dimethyloct 2 ene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: Total RNA was extracted from 2-week-old seedlings grown on an MS plate using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The amplicon library pools were isolated based on size by gel electrophoresis using a 2% agarose gel and then purified using QIAEX II Gel Extraction Kit (QIAGEN) and using 30uL of QIAEX II beads for each sample ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Genetics 2023Quote: ... The leaves were ground in liquid nitrogen and powder was resuspended in 2 ml of RLT buffer from RNeasy Plant Mini kit (Qiagen). For each sample ...
-
bioRxiv - Neuroscience 2024Quote: ... were added to each tube and samples were homogenized for 2×90s at 20 Hz using a TissueLyser II (Qiagen). Next ...
-
bioRxiv - Genetics 2024Quote: Tail clips were taken from 2 month postfertilization (mpf) zebrafish and DNA was extracted using the DNeasy Blood and tissue kit (Qiagen). DNA was PCR amplified with Q5 high fidelity DNA polymerase (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... slides from 25 epidemic KS and 2 endemic KS tumor biopsies and 5 samples of uninvolved skin using the AllPrep DNA/RNA FFPE Kit (QIAGEN). Gene expression analysis was performed on RNA samples on the Nanostring platform (Nanostring Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...
-
bioRxiv - Microbiology 2024Quote: ... treated with our LRA panel in the presence or absence of KL-2 was carried out with an RNeasy kit (Qiagen), with the optional on-column deoxyribonuclease I digestion step ...
-
bioRxiv - Molecular Biology 2024Quote: ... The swabs were removed after heat incubation at 56 °C for 2 hours by transferring samples including swab material to QIAshredder tubes (Qiagen) and centrifugation at 12,000 rcf for 2 min.
-
bioRxiv - Plant Biology 2024Quote: ... The fresh leaf discs were transferred to a 2 mL tube containing a 5 mm stainless steel bead and 500 µL buffer RLT (QIAGEN). The leaf discs were disrupted using a TissueLyser LT (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... 8 ml of bed volume of Ni-NTA resin (Qiagen, Germany) was added and incubated for one hour with gentle agitation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequences were manually curated with CLC Main Workbench 8 software (Qiagen) before being aligneed with the Muscle program implemented in the workbench to generate haplotypes by line for each intron ...
-
bioRxiv - Genomics 2021Quote: ... 8 and 10 of differentiation as recommended (RNAeasy Minikit. Qiagen 74106). Mineralized nodule formation was measured by staining cultures with Alizarin Red (40 mM ...
-
bioRxiv - Microbiology 2022Quote: ... and lysate was passed over 8 mL Ni-NTA resin (Qiagen) using gravity chromatography ...
-
bioRxiv - Immunology 2023Quote: ... and disrupted for 8 minutes in 300 μL ATL buffer (Qiagen) using a Qiagen Tissuelyser at 50Hz with a ceramic bead (MPBio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 wells of cell death control (Qiagen AllStars Positive Control siRNA), and 8 wells of YAP targeting siRNA (Ambion Silencer Select ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was passed over 8 ml of Ni-NTA resin (Qiagen), and the resin was washed with 70 ml of lysis buffer supplemented to 1 M NaCl followed by 20 ml lysis buffer ...
-
bioRxiv - Genetics 2021Quote: ... S2 cells were seeded at 1 × 106 cells/ml in a 6-well plate and transfected using Effectene (Qiagen, Germantown, MD). For mobility shift assay (Figure 4) ...
-
bioRxiv - Immunology 2023Quote: DNA was extracted from 1×10^6 CD4 Th cells/ replicate using the Qiagen DNA mini kit according to manufacturer’s instructions (Qiagen Hilden, Germany). DNA was extracted from 10ng of mouse brain tissue as previously described13 using NEB Monarch High molecular weight DNA extraction kit according to manufacturer’s instructions (NEB Cat #T3050).
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Plant Biology 2019Quote: ... 50,000 protoplasts in a volume of 100 μL were transformed with 20 μg of each plasmid (2 μg/μL) purified using the Plasmid Maxi kit (Qiagen, Germany). One batch of protoplasts was treated with an equivalent amount of water and used as the negative (untransformed ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted using enzymatic lysis and mechanical disruption of the cells and purified with the RNeasy mini kit (Protocol 2, Qiagen, USA). The RNA standard (25ng ...
-
bioRxiv - Cancer Biology 2021Quote: ... or CRTC3 or control sgRNA (Supplementary Table 2) were transfected into 293FT cells together with packaging plasmids pMD2.G and pSPAX2 using Effectene transfection reagent (Qiagen #301425). The viral supernatants were collected at 48 ...
-
bioRxiv - Genomics 2021Quote: ... The samples were then transferred to RNeasy spin columns and 2 ml collection tubes from an RNeasy Mini Kit (Qiagen, 74104) and centrifuged at 13,000 rpm for 15 sec ...
-
bioRxiv - Genomics 2022Quote: Buccal swab samples were placed in 2 mL Eppendorf tubes and were extracted using a modified version of the DNeasy® Blood and Tissue Kit (Qiagen). In each tube were added 380 μL of ATL Buffer and 20 μL of Proteinase K (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... The clinical Samples (cervical smear) for the HPV DNA test were processed using HPV Test Hybrid Capture® 2 protocol (QIAGEN). Samples with relative light units (RLU ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from a minimum of 2 × 106 sorted MDSCs or nonMDSCs using an RNAeasy Mini Kit (Qiagen, Germantown, MD). RNA sequencing was performed by GENEWIZ (South Palinfield ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Epidemiology 2020Quote: ... Then a steel ball was added and samples were crushed twice during 2 min at 30 Hz/s with the Tissue Lyzer (Qiagen, Germany). 450 µL of fresh PBS 1X were added to the samples ...
-
bioRxiv - Genetics 2019Quote: ... The whole body of a single insect was homogenized in a PCR well containing 50 μl of the Lysis & Binding Solution and zirconia beads (ø 2 mm; Nikkato) in TissueLyser II (QIAGEN) at 25 Hz for 30 s ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from 2 g of homogenized material from frozen needles using the DNeasy Plant Maxi Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... at and after 32-cell stage were extracted using Animal Tissue Direct PCR kit (FOREGENE) and those (~200) of unfertilized eggs and 2-cell embryos were purified using DNeasy® Blood & Tissue Kit (Qiagen). DNA fragments flanking target sites were amplified using primers listed in Supplementary Table S3 ...