Labshake search
Citations for Qiagen :
851 - 900 of 2222 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). Protein elution was carried out with a linear gradient of modified buffer B (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). The column was washed extensively with buffer A and subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cDNA was diluted 1:5 by adding 10 uL of buffer EB (Qiagen) using a Mantis liquid handler ...
-
bioRxiv - Physiology 2020Quote: ... DNA was isolated using Qiagen MagAttract PowerMicrobiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) on the EpMotion 5075 (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Microbiology 2020Quote: ... The soluble fraction was incubated for 1 hour at 4 °C using a Ni-NTA resin (Qiagen). The Ni-NTA resin was washed with 4 times resin volume (RV ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from 4 mg of ground lyophilized material using the RNeasy Midi kit (Qiagen). A DNase treatment (Ambion ...
-
bioRxiv - Cancer Biology 2022Quote: Cell pellets or pieces of xenografts were lysed in 4% SDS buffer using a QIAshredder (Qiagen, 79654). See Supplementary Table S1 for antibodies used ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from 4×107 KPC cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen). NGS libraries were prepared using the following primers:
-
bioRxiv - Microbiology 2020Quote: ... RNA extraction was performed from homogenate of 4 mg of lung tissue with RNeasy Mini Kit (Qiagen), or 50µl of serum using the NucleoSpin kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2022Quote: ... 97-mer shRNA oligonucleotides were synthesized (IDT) and 4 picomoles were amplified with HotStarTaq polymerase (Qiagen#203207) using the primers miR-E-fw (5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plates were coated with 100 μL of 4 μg/mL murine anti-His mAb (Qiagen, #34660), and after blocking ...
-
bioRxiv - Pathology 2021Quote: ... at 4°C and total RNA was extracted with the RNeasy Midi kit (Qiagen, Santa Clarita, CA). Mouse Genome 430A 2.0 arrays (Affymetrix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were kept at 4° for two days before extracting DNA using the DNeasy PowerSoil Kit (Qiagen). We also obtained DNA extracted from ...
-
bioRxiv - Genomics 2021Quote: ... sativa seedlings (∼1.5 weeks) and mature leaves (∼4 weeks) using the DNeasy Plant Mini kit (Qiagen #69104) and diluted to 5 ng/μl ...
-
bioRxiv - Immunology 2020Quote: 4 matched pairs of Treg and MulTreg were expanded and RNA extracted (RNeasy RNA extraction kit, Qiagen). cDNA was then produced (SMART cDNA synthesis kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... 565 E.coli colonies per guide ratio (>500x coverage) was used to process the 4 Maxi-Prep (Qiagen) reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°) and plasmids were extracted from the cell pallets using QIAprep Spin Miniprep kit (Qiagen, CA, USA). The sequences of the inserts were confirmed by Sanger sequencing (ACGT Inc ...
-
bioRxiv - Immunology 2022Quote: ... After mechanical disruption by shaking at 25/s over 4 min with metal beads (TissueLyser II, Qiagen), two 250 μL aliquots of the homogenate were stored at -80°C for viral plaque titration ...
-
bioRxiv - Genomics 2022Quote: ... and homogenized at 25/s for 1 min at 4°C using a TissueLyser II (Qiagen, 85300). Samples were incubated at room temperature for 5 min followed by addition of 180 μl chloroform ...
-
bioRxiv - Plant Biology 2022Quote: ... the clear supernatant was incubated for 4 h with 1.5 ml Ni-NTA agarose (Qiagen, Hilden, Germany) previously washed with 6 ml of distilled H2O and equilibrated with 6 ml of binding buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... Four wells were then harvested at the appropriate growth stage and combined with 4 mL RNAprotect (Qiagen) to generate each replicate ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was applied to 4 ml bed volume Ni-NTA Agarose beads (Qiagen, cat. No. 30210) for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Labchip analysis was performed to assess the size of small RNAs according manufacturer’s instructions (PerkinElmer).The Reverse transcription was performed on 4 ng RNA using miRCURY® LNA® RT Kit (Qiagen). Real-time quantitative PCR was performed on 40 pg cDNA using specific primers (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of field-saturated peat were added to 2.5 volumes of Lifeguard buffer (Qiagen, Maryland, USA), transferred out of the field on ice in a cooler ...
-
bioRxiv - Microbiology 2023Quote: ... RT buffer 5x (4 μL) RT primer mix and Reverse transcriptase (1 μL) (Qiagen, Cat. No. 205311) added in a final volume of 20 μL ...
-
bioRxiv - Biochemistry 2023Quote: ... The harvested cells of TonAmyGT and Chimera 4 were re-sususpended with non-denaturing lysis buffer (Qiagen) and 0.2 % of Sarcosyl and kept overnight for re-suspension ...
-
bioRxiv - Microbiology 2023Quote: ... aureus and 4 food-derived Staphylococcus bacteria were extracted using the DNeasy 96 Blood & Tissue kit (Qiagen). For sequencing analysis ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was collected 4 days post lentiviral shRNA transduction using RNeasy Plus Mini Kit (Qiagen #74134). Lentiviral transduction and RNA extraction were performed in triplicates ...
-
bioRxiv - Biochemistry 2023Quote: ... Affinity chromatography was carried out at 4°C with a Ni-NTA sepharose column (Qiagen, Hilden, Germany). The column was pre-equilibrated with 50 mM NaH2PO4-buffer pH 7.6 ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C) and the supernatant was loaded onto a Ni-nitrilotriacetic acid (NTA) column (Qiagen, Hilden, Germany). After a washing step (6 M urea ...
-
bioRxiv - Bioengineering 2024Quote: ... as indicated in Supplemental Information Table 4 and purified using a PCR purification Kit (QIAGEN, Hilden, Germany). Subsequent ligation with T4 DNA Ligase from NEB (Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... intermedia broth of OD600 of 0.8 was mixed with 4 ml RNAprotect Bacteria Reagent (QIAGEN, Venlo, Netherlands). The supernatant was removed after being centrifuged at 2200 xg for 5 min and stored at -80 °C before RNA extraction ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Immunology 2020Quote: ... The bacterial lysates were mixed for 1 h with 5 ml of Ni-NTA resin (Qiagen) that had been equilibrated with buffer A ...