Labshake search
Citations for Qiagen :
8851 - 8900 of 10000+ citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... gel extraction was performed using Qiaquick Gel Extraction kit (Qiagen, UK) and the samples sequenced to confirm fidelity (inhouse sequencing service).
-
bioRxiv - Cancer Biology 2019Quote: ... and DNA was purified using a QIAquick PCR purification kit (QIAGEN) after RNase and proteinase K treatment ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was extracted using the RNeasy Plus Universal Mini Kit (Qiagen), following the manufacturer’s instructions with the exception that 1-Bromo-3-chloropropane (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... and 66 h post-infection using QIAmp DNA micro kit (QIAGEN). Viral DNA forms of wild-type and mutant HIV-1 were amplified using real-time PCR (Butler et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Plasmid preparations were carried out using QIAprep Spin Miniprep Kit (QIAGEN). Primers and Synthetic DNA sequences (barcodes gBlocks ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse transcribed using either a QuantiTect Revese Transcription Kit (Qiagen) or Maxima H Minus Reverse Transcriptase (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were purified using QIAquick PCR Purification Kit (28106, Qiagen). S1 ...
-
bioRxiv - Biochemistry 2019Quote: PCR products were purified using the QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... and purified using the MinElute Gel Extraction Kit (Qiagen, Valencia, CA). Quality of the resulting NGS libraries was assessed by capillary electrophoresis using a Bioanalyzer DNA High-Sensitivity Chip (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted using the Allprep DNA/RNA FFPE kit (Qiagen) using the manufactures protocol ...
-
bioRxiv - Genetics 2019Quote: ... it was purified using QIAquick PCR Purification Kit (Qiagen, Chatsworth, CA). The amplicon program consisted of 3 min at 96 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were purified using QIA quick PCR Purification Kit (Qiagen, Hilden, Germany) or were cleaned using a standard Exo-SAP protocol (5 μl PCR product and 1 μl of Exo-SAP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were prepared using QIAseq Ultralow Input Library Kit (Qiagen, #180492). Final libraries were directly PCR amplified from Streptavidin beads ...
-
bioRxiv - Physiology 2020Quote: Total RNA was extracted from hearts using RNeasy Mini kits (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was harvested from 1,000,000 cells using the RNEasy Kit (Qiagen). 1 μg of total RNA was used as input for cDNA synthesis ...
-
bioRxiv - Pathology 2020Quote: RNA was prepared using a miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and further processed in Illumina’s TruSeq Stranded mRNA Library kit (Qiagen). Libraries are sequenced on Illumina NextSeq 500 as paired-end 42-nt reads ...
-
bioRxiv - Cancer Biology 2020Quote: ... was isolated using the DNeasy Blood & Tissue kit (Qiagen, Venlo, Netherlands). Genomic PCR was performed using 30 ng of genomic DNA for the detection and verification of the biallelic deletion within the mouse Lcn2 gene.
-
bioRxiv - Molecular Biology 2019Quote: Total RNA were extracted using the RNeasy Mini Kit (Qiagen #74106) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was then generated using the QuantiTect Reverse Transcription kit (Qiagen).
-
bioRxiv - Neuroscience 2019Quote: ... Genomic DNA was purified from tail tip biopsies (Qiagen DNeasy kit) to screen potential founders for correct insertion of iCre.
-
bioRxiv - Cancer Biology 2019Quote: ... DNA was extracted using the QIAamp DNA Blood mini kit (Qiagen) for cell culture samples or using the QIAamp DNA FFPE Tissue kit and deparaffinisation solution (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted using the RNeasy kit (Qiagen, Valencia, CA, USA) and cDNA was generated from 1 μg of RNA using SuperScript IV First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA extraction was performed using the DNeasy Plant Mini Kit (QIAGEN) and NucleoSpin Plant II (Macherey Nagel) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We extracted DNA using QIAmp DNA Mini Kits (Qiagen, Hilden Germany) and stored DNA at −80°C until sequencing.
-
bioRxiv - Cancer Biology 2019Quote: ... Other samples were processed using the AllPrep DNA/RNA kits (Qiagen). Nucleic acid quality control was ensured with NanoDrop (Thermo Fisher ...
-
bioRxiv - Systems Biology 2019Quote: ... Amplicons were PCR-purified using the QIAquick PCR Purification Kit (Qiagen), and subsequently labeled using the BioPrime DNA Labeling System (Invitrogen) ...
-
bioRxiv - Genomics 2019Quote: ... DNA was purified using a MinElute PCR purification kit (Qiagen #28004) and libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (NEB #E7645S) ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using the DNA blood and tissue kit (Qiagen) followed by phage and Curvibacter sp ...
-
bioRxiv - Genetics 2019Quote: ... Total mRNA was extracted using RNeasy Plus Mini Kit (QIAGEN, 74134) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: We extracted DNA following a modified DNeasy PowerSoil Kit (Qiagen Inc.) protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR was carried out using QuantiFast SYBR Green PCR Kit (Qiagen) or SYBR Green PCR Master Mix (Applied Biosystems) ...
-
DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cellsbioRxiv - Synthetic Biology 2019Quote: Genomic DNA was extracted with the QIAmp DNA Micro Kit (Qiagen) and carrier RNA (for Figure S4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and total RNA was extracted using a miRNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: RNA extraction was done with RNeasy® Plus Micro Kit (Qiagen) according to the protocol ...
-
bioRxiv - Immunology 2019Quote: ... Total mRNA was extracted using RNeasy Plus Mini Kit (Qiagen #74104). RNAseq was performed at The Center for Medical Genomics at Indiana University School of Medicine ...
-
bioRxiv - Microbiology 2019Quote: ... we extracted genomic DNA with the MO Bio PowerFecal kit (Qiagen) automated for high throughput on QiaCube (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... RNA was reverse transcribed using Quatitect Reverse Transcription Kit (Qiagen 205313). Quantitative PCR analysis was performed using SYBR Green Quantitative PCR Master Mix (Roche 0692404001 ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified with the use of a QIAquick Gel Extraction Kit (Qiagen), and sequenced ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was purified from the lysate using RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was isolated by RNeasy Micro or RNeasy Mini kits (Qiagen) followed by cDNA synthesis using the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific).
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was extracted using the RNeasy mini kit buffers (Qiagen) and purified on RNA-binding spin columns (Epoch) ...
-
bioRxiv - Microbiology 2019Quote: ... ChIPed DNA was purified using a PCR clean up kit (Qiagen). For input samples (an aliquot of the sonicated ...
-
bioRxiv - Physiology 2019Quote: ... and RNA samples were purified using the miRNeasy kit (#1038703, Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using random and HAstV1-specific reverse primers ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA transcripts were purified using the RNeasy mini kit (QIAGEN), eluted with RNAse-free sterile water and stored at −80°C prior to use.
-
bioRxiv - Developmental Biology 2019Quote: ... RNA was extracted from individual samples using RNAeasy Micro Kit (QIAGEN). For RNA-seq ...
-
bioRxiv - Developmental Biology 2019Quote: ... The two supernatants were combined and purified with MinElute kit (Qiagen) in 22µl of EB buffer ...