Labshake search
Citations for Qiagen :
8601 - 8650 of 10000+ citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Total RNA was extracted using RNeasy Mini kit (Qiagen, Germany) following manufactureŕs instructions ...
-
bioRxiv - Genomics 2022Quote: ... followed by purification by using RNeasy Minelute kit (Qiagen, 74204). STARR-seq reporter library was prepared by following protocol as described in ref.[17] and paired end sequenced.
-
bioRxiv - Genomics 2022Quote: ... cDNA was purified using a Reaction Cleanup Kit (Qiagen #28206) and amplified using custom STARR-Seq transcript–specific primers (Supplemental Table 1 ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted by using RNeasy Mini Kit (Qiagen), and the cDNA was synthesized utilizing iScript Reverse Transcription kit (Bio-Rad) ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted with the DNeasy Plant Mini Kit (QIAGEN) following the manufacturer’s instructions and size-selected for fragments larger than 40 Kbp using BluePippin (SAGE Sciences) ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted with DNeasy PowerSoil Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2023Quote: ... and purified with the QIAquick PCR Purification Kit (Qiagen; 28104). Long-read sequencing was performed on a MinION sequencer (Oxford Nanopore Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gDNA was extracted using AllPrep DNA/RNA Mini kit (Qiagen), followed by genotyping of each colony using KOD One PCR Master Mix (DiagnoCine ...
-
bioRxiv - Evolutionary Biology 2023Quote: Genomic DNA was extracted using the DNeasy Plant Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were cleaned using an RNEasy MinElute Cleanup Kit (Qiagen) and diluted in RNAse-free water and kept at −80C ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA was extracted with an RNeasy Mini Kit (Qiagen, 74104). 1.2-2.1 μg were used as a template to generate a sequencing library with the NEBNext Ultra II Directional PolyA mRNA (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and purified by LiCl precipitation or RNeasy mini kit (Qiagen). RNA in 5-10 nl of RNase-free water (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... samples were additionally purified using the RNeasy Mini kit (Qiagen).
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using the miRNeasy micro kit (Qiagen) and quantified via RNA assay on a tape station 4200 system (Agilent) ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated using the RNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cleaned up further using RNeasy Mini kit purification (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA extraction was performed using RNeasy mini kit (QIAGEN 74106) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cleaned up further using RNeasy Mini kit purification (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: Plasmids were purified using a MaxiPrep DNA isolation Kit (Qiagen). For virus packaging ...
-
bioRxiv - Developmental Biology 2023Quote: ... Amplified DNA was purified using Qiagen MinElute Kit (Qiagen, 28004). A size-selection of libraries was performed using SPRIselect beads (Beckman ...
-
bioRxiv - Developmental Biology 2023Quote: RNA extraction was done using RNeasy mini kit (Qiagen, Germany). cDNA was synthesized using High Capacity cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then extracted with the Puregene DNA Kit (Qiagen) per the manufacturer’s protocol for tissues ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... then purified using the QIAquick PCR Purification Kit (Qiagen, 28106). The eluent was split into 3 tubes for the subsequent second step PCR ...
-
bioRxiv - Cancer Biology 2022Quote: RNA extractions were performed using the RNeasy kit (QIAGEN 74106) and the QIAshredder spin columns (QIAGEN 79656) ...
-
bioRxiv - Immunology 2023Quote: ... and total RNA was isolated using RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA was extracted using RNeasy® Mini kit (Qiagen). RNA was quantified on a Nanodrop ND-100 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Trace DNA was digested using the DNase Max Kit (Qiagen). RNA quantity and integrity was confirmed with nanodrop (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using a PCR purification kit (Cat# 28104, Qiagen). ChIP-seq libraries were made using the MicroPlex Library Preparation kit V2 (C05010012 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was then extracted using the RNeasy Mini Kit (Qiagen) as per manufacturer directions from three biological replicates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using a forward primer (GGCAAACAACAGATGGCTGGCAAC ...
-
bioRxiv - Genomics 2023Quote: ... followed by purification with the Qiagen RNeasy kit (Qiagen, USA). RNA was harvested using Rneasy mini plus kit (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... RNA was harvested using Rneasy mini plus kit (Qiagen, USA). 2 ug of total RNA was used for the construction of sequencing libraries ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Qiagen miRNEasy Mini Kit (Qiagen, #217004) according to manufacture instructions ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was extracted using the RNeasy Mini Kit (Qiagen) from the heads and bodies of 15 days old D ...
-
bioRxiv - Microbiology 2023Quote: ... and further purified using the DNeasy PowerClean CleanUp kit (QIAGEN). Consequently ...
-
ENGRAILED-1 transcription factor has a paracrine neurotrophic activity on adult spinal α-motoneuronsbioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen). RT-qPCR was done using SYBR-Green (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was purified from Ishikawa cells using RNeasy kit (Qiagen). RNA quality was evaluated using a Bioanalyzer 2100 (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... followed by column purification per manufacturer’s recommendation (Qiagen, Minelute Kit). DNA was eluted from the columns in 22ul H2O ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... polygyrus adult nematodes was isolated using the miRNAeasy kit (Qiagen) and visualized on a bioanalyzer (RIN > 7.0 ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted with Qiagen Blood and Tissue Kit (Qiagen), PCR was carried out with primer targeting pos ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA extraction was performed using RNeasy Micro RNA kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA extraction was performed using RNeasy Micro RNA kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR cleanup/gel extraction kits (Qiagen or IBI-MidSci) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted using the RNeasy Mini kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted using the RNeasy Mini Kit (Qiagen) and treated with the RNase-Free DNase Set (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using the RNeasy Micro kit (Qiagen). RNA was hybridized to the Affymetrix Mouse 1.1 ST genechip at the Ramaciotti Centre for Gene Function Analysis at the University of New South Wales ...
-
bioRxiv - Cell Biology 2023Quote: ... and purified with the RNeasy MinElute Cleanup Kit (QIAGEN, #74204). mRNA was injected into embryos at the 1-cell stage in the following amounts ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids were amplified with the QIAprep Spin miniprep kit (Qiagen) and linearized with Not1-HF (New England Biolabs) ...
-
bioRxiv - Immunology 2022Quote: ... RNA-Isolation was performed using the RNeasy Micro Kit (Qiagen) on a QiaCube (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the QIAamp DNA Blood Maxi kit (Qiagen, Cat # 51192). Genomic DNA was amplified for Illumina sequencing using sgRNA library primers as described previously16 and was sequenced on the HiSeq2500 platform with 31 bp paired-end reads ...