Labshake search
Citations for Qiagen :
8551 - 8600 of 10000+ citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... before being purified using a Qiaquick PCR purification kit (Qiagen, #28104).
-
bioRxiv - Biophysics 2021Quote: gDNA was isolated using the DNeasy Blood & Tissue Kit (Qiagen #60506) and the target region was amplified via PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen). Libraries were prepared by nested PCR method as described previously 49 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was extracted from cells using the RNeasy mini kit (Qiagen). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... using the IndiMag® Pathogen Kit (QIAGEN® GmbH, Hilden, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was isolated using a RNeasy Plus Mini Kit (Qiagen). BGI performed the library preparation and sequencing at 50 base pair (BP ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by extraction using the RNeasy Mini Kit (Qiagen, Hilden Germany). RNA (1 µg ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was extracted from miRNeasy kit from Qiagen (cat. No. 217004) and mRNA-seq was performed as described before [96].
-
bioRxiv - Neuroscience 2021Quote: ... DNA was purified and eluted using MinElute PCR purification kit (Qiagen). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA extraction was performed immediately thereafter using RNAeasy Kit (Qiagen, 74104) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was extracted with the RNeasy mini kit (Qiagen, 74106) plus on-column DNAse I digestion (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated using the RNeasy mini kit (Qiagen, # 74104). Following RNA isolation ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated using the RNeasy Plus Mini kit (74134, Qiagen) and sent to the Weill Cornell Medicine Genomics Core facility ...
-
bioRxiv - Cancer Biology 2021Quote: ... The total RNA was extracted using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from the cells using RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was first extracted using Qiagen RNEasy kits (Qiagen, Hilden, Germany). cDNA was then created from the RNA samples using an iScript kit (BioRad ...
-
bioRxiv - Genomics 2021Quote: ... and DNA was purified with QIAquick PCR purification kit (QIAGEN 28106). ChIP-seq libraries were constructed using the Illumina’s TruSeq ChIP sample preparation kit (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was then isolated using the RNeasy mini kit (Qiagen, 74104). Expression data were generated using Affymetrix Clariom S arrays.
-
bioRxiv - Cancer Biology 2021Quote: ... and the RNeasy PowerLyzer Tissue & Cells Kit (Qiagen, CAT # 15055-50) was used to extract RNA from peripheral blood mononuclear cells (PBMCs ...
-
bioRxiv - Microbiology 2020Quote: ... and then total RNA was extracted using a RNeasy kit (Qiagen). Genomic DNA was removed using the Turbo DNA-free kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA extraction was completed using RNEasy mini kit (Qiagen, 74106) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Total cellular RNA was extracted using an RNeasy mini kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Total DNA was prepared using DNeasy Blood and Tissue Kit (Qiagen). Validated primers for Mitochondrial (CCCATTCCACTTCTGATTACC ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted using the DNeasy Blood and Tissue kit (QIAGEN); quality and concentration were verified using a UV-Vis spectrophotometer (Thermo Scientific NanoDrop One) ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: Total RNA was purified by using RNeasy mini kit (Qiagen #74104) by following the company's instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Precipitated DNA samples were purified by QIAquick PCR purification kit (Qiagen) and quantified by Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was extracted from cell pellets (DNeasy Blood & Tissue Kit, Qiagen) and stored at −80°C until completion of screens ...
-
Chromatin accessibility changes at intergenic regions associates with ovarian cancer drug resistancebioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from cells using the Gentra PureGene kit (Qiagen). 1μg purified DNA was sheared using Bioruptor Pico (Diagenode ...
-
bioRxiv - Cell Biology 2020Quote: RNA samples were extracted using the RNeasy Mini kit (Qiagen, 74104), and the quality of total RNA was assessed by the 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: After RNA extraction using the RNeasy Micro or Mini Kit (QIAGEN), quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA from spleen was digested overnight with DNeasy extraction kit (Qiagen) for further downstream qPCR analysis.
-
bioRxiv - Cell Biology 2020Quote: ... RNA was isolated using the RNeasy RNA purification mini kit (QIAGEN) or GeneJET RNA purification kit (Thermo Fisher (according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated with the DNeasy Blood & Tissue kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and the DNA was purified using the PCR Purification kit (Qiagen). Purified DNA was then subjected to quantitative PCR using three sets of primers targeting the promoter region of atgl-1 ...
-
bioRxiv - Cell Biology 2020Quote: ... exosomal RNA was isolated using the miRNeasy Serum/Plasma Kit (QIAGEN) followed by reverse transcription using the TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... cell-derived microvesicles were collected using the ExoEasy Kit (Qiagen 76064) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was isolated from cells using a Gentra Puregene kit (Qiagen). DNA was quantified by fluorometry using QuBit 2.0 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was extracted using a Gentra Puregene Core kit (Qiagen). Lentiviral sgRNA inserts were amplified in a two-step PCR (with Illumina adapters added on the second PCR) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cignal Pathway Reporter Assay Kits were from QIAGEN (Frederick, MD, USA). The Dual-Luciferase Reporter Assay System was purchased from Promega (Madison ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was reverse-transcribed with the miScript II RT Kit (Qiagen) and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA was synthesized using the QuantiTect Reverse Transcription kit (QIAGEN). SybrGreen quantitative RT-PCR experiments were performed as described in the manual using QuantStudio™ 6 Flex Real-Time PCR System ...
-
bioRxiv - Cell Biology 2020Quote: ... Subsequently cDNA was generated employing the QuantiNova Reverse Transcription Kit (Qiagen) according to recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was collected 7 days post-TGFB1 treatment (RNAeasy Kit, Qiagen). cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was extracted using RNeasy Plus Micro kit (Qiagen, Hilden, Germany) after 4 hour exposure as per protocol ...
-
bioRxiv - Immunology 2021Quote: ... Plasma vRNA was extracted by QIAamp Viral RNA Mini Kit (QIAGEN) and quantified by real time PCR (ABI Applied Biosystem ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated using QIAamp DNA Micro Kit (56304, Qiagen). The number of genomic viral integration sites was compared with the number of housekeeping genes using a ddPCR—BioRad QX200 AutoDG Droplet Digital PCR System (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNA fragments were then purified with QIAquick PCR kit (Qiagen). A 10% input sample of each condition was used to generate a standard curve and the copy numbers of each immunoprecipitate is presented relative to the standard curve ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was harvested using the DNeasy blood and tissue kit (Qiagen). The qPCR assays were carried out in a LightCycler96 system (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: RNA was isolated from cells using a RNeasy mini kit (Qiagen), and then 400 ng to 1 μg of RNA was DNase I-treated according to the manufacturer’s protocol (ThermoFisher Scientific) ...