Labshake search
Citations for Qiagen :
801 - 850 of 6945 citations for Somatostatin Receptor 4 SSTR4 Rabbit Polyclonal affinity purified biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified (MinElute PCR Purification Kit, Qiagen) and stored at −80°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and purified with the RNeasy Mini Kit (Qiagen). Antisense RNA probes were synthesized as described (Racioppi et al. ...
-
bioRxiv - Immunology 2022Quote: ... were purified using Ni-NTA Agarose resin (QIAGEN). Fab fragment of NCV2SG53 was isolated from papain digests of the monoclonal antibody expressed in Expi293F cells using HP Protein G column (Cytiva) ...
-
bioRxiv - Immunology 2022Quote: ... treatment and purified away by Ni-NTA (Qiagen). Truncated ΔQP–hCCL2 was expressed in E ...
-
bioRxiv - Immunology 2022Quote: ... treatment and purified away by Ni-NTA (Qiagen). ΔQP–mCCL7 was expressed in E ...
-
bioRxiv - Genomics 2019Quote: ... the DNA was purified (Qiagen PCR purification kit). dATP was added with Klenow exo- (NEB ...
-
bioRxiv - Genomics 2019Quote: ... Digested DNA was purified with MiniElute columns (Qiagen). The Pippinprep (SAGE science ...
-
bioRxiv - Genomics 2019Quote: ... Ligated DNA was purified using MiniElute columns (Qiagen). For each library ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6.67mM m6A) and purified through RNeasy columns (Qiagen) following the manufacturers protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and gel purified using Gel Extraction Kit (Qiagen). Isolated transcripts were ligated into pEGFP-C2 using Quick Ligation Kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified by MinElute PCR purification kit (Qiagen).
-
bioRxiv - Genomics 2019Quote: ... Individual PCR products were silica column-purified (Qiagen), inspected by TapeStation for their predicted amplicon size ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Plasmids were purified using a Miniprep Kit (QIAGEN) and individually sequenced (GENEWIZ) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purified using RNeasy mini kit (QIAGEN, 74104). Dppa3 or mutant Dppa3 (R107E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified using QIAprep Spin Miniprep Kit (Qiagen) and then sequenced by Sanger sequencing to confirm mutagenesis (Eurofins Genomics).
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified using a miRNeasy mini kit (Qiagen). Nls-Cas9-nls104 mRNA was transcribed using the mMessage mMachine T3 kit (Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... and purified using the RNeasy Mini Kit (QIAGEN). Biotinylated RNA was incubated with cell lysate ...
-
bioRxiv - Genomics 2019Quote: ... and purified using QIAquick gel extraction kit (Qiagen). The libraries were then pooled at equal concentrations and ran on a HiSeq × 2×151 bp run.
-
bioRxiv - Microbiology 2019Quote: ... and further purified using a RNeasy kit (QIAGEN) according to manufactures’ instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was purified using the minElute kit (Qiagen). 6-10ng of immunoprecipitated material was used for ChIP-seq library preparation using the KAPA Hyper prep kit (KAPA Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... and purified with Endofree plasmid maxi kit (Qiagen).
-
bioRxiv - Physiology 2020Quote: ... and purified with the RNeasy Mini Kit (QIAGEN). Folded RNAs (3 ug ...
-
bioRxiv - Immunology 2019Quote: ... and purified with the Gel Extraction Kit (Qiagen).
-
bioRxiv - Microbiology 2019Quote: ... The 4267 bp product was gel-purified (Qiagen) and introduced into pSCrhaB2 by restriction cloning using NdeI and HindIII (NEB) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... purified on a PCR cleanup column (Qiagen 28106), and ligated into BamHI/ HindIII-linearized and gel-purified pET28 ...
-
The epigenomic landscape regulating organogenesis in human embryos linked to developmental disordersbioRxiv - Genomics 2019Quote: ... The resulting chromatin was then purified (MinElute, QIAGEN).
-
bioRxiv - Genomics 2019Quote: ... was further purified using the MagAttract kit (Qiagen). Sequence-ready libraries were then prepared from 500 ng to 1 µg of intact (non-sheared ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were purified with Ni-NTA beads (Qiagen). Proteins and beads were washed 3 times with protein purification lysis buffer before incubating the beads with elution buffer (400 mM imidazole in protein purification lysis buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... then purified using QIAquick PCR purification kit (Qiagen). Amplicons were sequenced by Sanger sequencing using Exon2seqRev (CCCGCAATTACAACATGCTAG ...
-
bioRxiv - Immunology 2021Quote: ... and purified RNA was treated with DNase (Qiagen) to remove DNA ...
-
bioRxiv - Genomics 2019Quote: ... purified with a QIAquick Gel Extraction kit (Qiagen) and sequenced in both directions with the original set of primers on a 3730XL DNA Analyzer (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and purified by QIAquick Gel Extraction Kit (Qiagen). Libraries were sequenced on HiSeq 2500 instrument.
-
bioRxiv - Synthetic Biology 2021Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen) and eluted in 80 µL H2O ...
-
bioRxiv - Microbiology 2021Quote: ... and gel purified (QIAquick Gel Extraction Kit, Qiagen). Libraries were then quantified and sequenced with a 600 cycle MiSeq Reagent Kit (270×270 ...
-
bioRxiv - Microbiology 2021Quote: ... and gel purified (QIAquick Gel Extraction Kit; Qiagen). Libraries were then quantified (KAPA Library Quantification Kit ...
-
bioRxiv - Cell Biology 2019Quote: ... and purified with a silica column (Qiagen Maxiprep). Plasmids were confirmed by restriction digest and agarose gel electrophoresis ...
-
bioRxiv - Bioengineering 2020Quote: ... The resulting PCR amplicons were gel-purified (Qiagen) and processed for Sanger sequencing (Applied Biosystems 3730xL DNA Analyzer).
-
bioRxiv - Bioengineering 2019Quote: ... purified using RNeasy mini kit (Qiagen, Germantown, MD), and genomic DNA was digested using Optizyme™ recombinant DNase-I digestion kit (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... Purified plasmid (Plasmid Plus Midi Kit, QIAGEN, Germany) was mixed with selection plasmid pCoBlast (1:10 ...
-
bioRxiv - Biochemistry 2020Quote: ... SUMO1 was purified using Ni NTA-agarose (Qiagen), dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein was purified using Ni-NTA agarose (Qiagen) eluting with 300 mM imidazole ...
-
bioRxiv - Neuroscience 2021Quote: ... and purified using an RNeasy mini kit (Qiagen). Injection solutions were prepared with a final concentration of 300ng/µl nCas9n mRNA and 10ng/µl sgrNA in nuclease free water and 0.05% (w/v ...
-
bioRxiv - Neuroscience 2021Quote: ... We purified RNA with RNeasy Micro columns (Qiagen) and performed an optional on-column DNase digestion ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purified using the RNAeasy mini kit (Qiagen). Agilent High Sensitivity RNA Screentape (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA was purified with QIAquick column (Qiagen). Sequencing libraries were prepared using Ovation Ultralow System (Nugen/Tecan ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified with Ni-NTA-agarose (#166038887, Qiagen) as previously described17 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were gel-purified (Qiagen, Hilden, Germany), cloned into the non-directional Gateway PCR8 vector (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... then purified using MinElute Columns (Qiagen; Cat#: 28004). The sgRNA (50ng/uL ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was purified with RNeasy Minikit columns (Qiagen) and analysed for quality with RNA 6000 Nano chips on the Agilent 2100 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and purified using spin column purification (Qiagen, 28106). Background plasmid was digested using Dpn1 (New England Biolabs ...