Labshake search
Citations for Qiagen :
801 - 850 of 2297 citations for Mouse Anti HIV 1 p24 Recombinant Antibody clone 183 H12 5C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: Genomic DNA was extracted from fibroblasts obtained from each individual mouse from each of the five non-CC inbred strains using AllPrep DNA/RNA Mini kit (Qiagen, #80204). The concentration and purity of extracted DNA was determined using a NanoDrop 2000 UV-vis spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2 expression or SARS-CoV-2 nucleocapsid (N) gene in individual mouse organs was determined using QuantiNova SYBR Green PCR kit (Qiagen #208052) in combination of 500 nM of hACE2 gene specific primer set (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from mouse cortices (~0.25 mg per sample) and infected neuronal cultures (5w2d post transduction) using RNeasy kits (Qiagen, 73304&73404) according to the manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA from cultured cells and mouse Achilles tendons were isolated with TRIzol reagent and RNeasy Mini Spin Column (Qiagen Sciences) and reversely transcribed into cDNAs using a SuperScript IV VILO Master Mix (Life Technologies).22,30 The relative abundances of genes of interest were determined by TaqMan PCR using primers and probes purchased from Applied Biosystems TaqMan Gene Expression Assays ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was performed using Real-time PCR for RT2 Profile PCR Array Mouse Cytokine and Chemokines using RT2 SYBR® Green Mastermixes (Qiagen). Using the RT2 qPCR Array Data Analysis spreadsheet ...
-
bioRxiv - Neuroscience 2024Quote: ... L4 and L5 DRGs of each mouse were collected and total RNA was extracted using RNeasy Mini Kit (QIAGEN, Cat# 74104). For cDNA synthesis ...
-
bioRxiv - Cell Biology 2024Quote: ... approximately 15-20 mg of mouse intestine tissue were used for RNA purification using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... all samples were diluted to the same RNA concentration and 250 ng of RNA from each sample spiked with 100 ng mouse RNA to control reaction efficiency were reverse transcribed using the miScript II RT kit (Qiagen, 218161) with HiFlex Buffer according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... DNA from Gsdmd/D1/D1l3−/− mouse tails was amplified using a genotyping mix containing a dNTP mix (10 mM, Qiagen, 201901), Taq DNA polymerase (250 U ...
-
bioRxiv - Molecular Biology 2024Quote: HBEC cells (5e5) from different treatments were mixed mouse RPE1 cells (5e5) for harvesting total RNA using RNeasy kits (Qiagen #74104) for reverse transcription with iScriptTM reverse transcription supermix (Bio-Rad #1708840 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The freshly isolated chondrocytes were plated at the density of 1.2 x 105/cm2 and reverse transfected on the PCR array plate (RT² Profiler™ PCR Array Mouse Extracellular Matrix & Adhesion Molecules, Qiagen). On the next day ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA and RNA co-isolation of mouse striatal punches were prepared with the AllPrep DNA/RNA 96 kit AllPrep DNA/RNA Kit (Qiagen, #80284) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from a day zero pre-injection sample and mouse tumors using a DNeasy Blood and Tissue Kit (Qiagen 69504) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Anti-Penta-His Alexa Fluor 488 conjugate was from Qiagen.
-
bioRxiv - Immunology 2023Quote: ... followed by magnetic depletion using goat anti-rat beads (QIAGEN). For adoptive transfer experiments ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA and miRNA fractions were isolated from the mouse frozen tissue with the miRNeasy Micro Kit protocol (Qiagen, Toronto, ON, Canada). All RNA samples were determined to have 260/280 and 260/230 values ≥1.8 ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted and purified from 20 mg (2 pellets) of stool from each mouse using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, MD). The concentration of DNA in samples was determined by spectrophotometry ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: DNA was isolated from tail biopsies using the Gentra Puregene Mouse Tail Kit according to the manufacturer’s instructions (Qiagen, Valenica, CA, USA). Genomic DNA was digested with BamHI-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Total genomic DNA was extracted from each ked lysate and blood (camel, mouse, and rabbit) using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Vγ4+TCRγδ+CD3+CD44+CD27− and Vγ4−TCRγδ+CD3+CD44+CD27− populations from each mouse strain were sorted using a FACSAriaIII: populations into RNA protect (QIAGEN, Hilden, Germany). Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... for subsequent RNA extraction and analysis using the Qiagen RT2 Profiler Mouse Innate and Adaptive Immune Response PCR Array (Qiagen, Hilden, Germany). The lungs were placed in a tissue cassette ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... First strand cDNA was synthesized from 0.5 mg of total RNA using QIAGEN RT2 First Strand Kits and transcripts for mouse cytokines and chemokines were quantified using qPCR microarrays comprising 96-well plates precoated with primers (QIAGEN PAMM-150Z). Each 96-well plate also contained primers for 5 housekeeping genes as well as positive and negative controls ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from the tail tip of a wild-type C57BL/6J mouse using the DNEasy Blood and Tissue Kit (Qiagen, Hilden, Germany). The genomic C-terminal region of OGT was amplified using the Q5 Hot Start High Fidelity 2x master mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was purified from the blood of a transfer mouse using the Qiagen QIAamp DNA Blood Kit (Qiagen, Cat# 51106), and genotyping PCR was performed to assess integration into the target locus ...
-
bioRxiv - Pathology 2022Quote: ... was performed using the Qiagen Mouse Inflammatory Response and Autoimmunity (PAMM-077Z) and Mouse Extracellular Matrix and Adhesion Molecules (PAMM-013Z) RT2 Profiler PCR arrays (Qiagen, Hilden, Germany) to evaluate relative gene/mRNA expression in WT compared to mdx and treated compared to untreated muscles ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from blood-free cranial lobes of the right mouse lung using the RNeasy Tissue Mini Kit (Qiagen, Hombrechtikon, Switzerland). Isolated RNA was reverse-transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and the cDNA was loaded onto the “Mouse Toll-Like Receptor Signaling Pathway” RT2 Profiler PCR Array according to the manufacturer instructions (Qiagen, Valencia, CA). Expression of the target genes were normalized to the geometric mean of Ct values of the two housekeeping genes Gusb and Hsp90a using the ddCt method (n = 3) ...
-
bioRxiv - Immunology 2023Quote: Total cellular RNA was extracted from mouse placental tissues or HTR8 cells using a RNeasy Plus Mini Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: DNA was prepared from tail biopsies obtained at approximately 2-weeks of age (Gentra Puregene Mouse Tail Kit, Qiagen, Valencia, CA, USA). Scn1a genotype was determined as previously described (Kearney et al ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNAs and genomic DNA from lavage fluids and mouse tissue homogenate were extracted using AllPrep® DNA/RNA Micro Kit (Qiagen, #80284). The tissue homogenate was prepared by disrupting frozen tissue in pre-chilled Lysing Matrix D 2 mL tube (MP Biomedicals ...
-
bioRxiv - Neuroscience 2024Quote: Vector genome copy number was quantified by qPCR analysis of total DNA extracted from mouse tissues using Qiagen DNeasy Blood and Tissue kit and Tissue Lyser II (Qiagen, Hilden, Germany). Genomic RNA was eliminated by RNase digestion (Qiagen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... These conditions and time points totaled 72 samples of mouse total RNA that was extracted by a Qiagen RNeasy kit (Qiagen, cat#74104) with RNase-free DNase Set (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Microbiology 2024Quote: ... sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using Penta-His antibody (QIAGEN)) were pooled and concentrated using Amicon filter devices with 10 kDa molecular weight cut-off (Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...