Labshake search
Citations for Qiagen :
801 - 850 of 950 citations for Hexadecanoic acid 3 trimethylsilyl oxy methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: Total RNA was isolated from untreated or RNP-transfected plerixafor-mobilized HD and SCD HSPCs (n=3 for each group) using the RNeasy Kit (QIAGEN) that includes a DNAse treatment step ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Plant Biology 2022Quote: ... frozen in liquid nitrogen, ground to a fine powder (3 mm glass beads added to tissue, ground using tissue lyser (TissueLyser II, QIAGEN), 30/second frequency ...
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Cells were lysed in 3% SDS in 10mM Tris pH = 7.5 by pipetting then centrifuge through a Qiashredder column (Qiagen #79656). Protein concentrations were determined by BCA assay (Thermo Fisher Scientific #23225) ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Cell Biology 2023Quote: ... All tissue samples were then centrifuged at top speed for 3 minutes and total RNA was purified from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNAs were purified from 3 mL overnight cultures grew at optimum temperature (30 °C or 37 °C) by Dneasy Blood & Tissue Kits (QIAGEN). Additionally ...
-
bioRxiv - Biochemistry 2023Quote: ... K-R or K-Q mutant cells (post PNKP 3’-UTR siRNA transfection and GO/Bleo treatment) was performed using the QiaAmp DNA Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... Second strand synthesis was performed after thawing by the addition of 5 µL of second strand synthesis mix (3 µL of elution buffer [Qiagen] ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from 2000 cells per replicate and 3 replicates per treatment by the micro RNeasy kit (QIAGEN) for both mouse muscle satellite cells and ZeMPCs ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Genetics 2022Quote: RNA from cortex and hippocampus derived ex vivo cultures was extracted from 3 biological replicates for three time points (DIV3, DIV15, DIV31) using RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using a SuperScript IV Reverse Transcriptase cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2023Quote: DNA extraction was carried out with 37 mg of freeze-dried mycelium using the Nucleospin Microbial DNA kit in combination with 3 mm tungsten carbide beads (Qiagen) for tissue disruption in a MM 301 vibratory mill ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was harvested from 2-3 million HIV-dreGFP infected Jurkat cells exposed to EPZ-719 (500nM) or control (DMSO) using a RNEasy kit (Qiagen). RNA quantity and quality were then analyzed by nanodrop and Tapestation (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the FT and Eluate fractions (90 µL each) were mixed with 10 µL 3 M sodium acetate and applied to a QIAquick spin column (Qiagen). Purified DNA was visualized a 1.3% agarose / 0.5x TBE gel and SYBR Green staining ...
-
bioRxiv - Cell Biology 2023Quote: Cells were cultured on a glass substrate and soft hydrogel for 3 days and total RNA was extracted using RNeasy mini kit (Qiagen). RNA quantity and purity were verified using 2200 TapeStation system (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cell lines in 3 biological replicates after each CRISPR/Cas9 oncogene downregulation using QIAzol (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP+ and GFP- nuclei were sorted using a BD AriaFACS III (University of Washington Pathology Flow Cytometry Core) into a PCR tube strip containing 3 µL of REPLI-g Advanced Single Cell Storage buffer (Qiagen). Whole genome amplification (WGA ...
-
bioRxiv - Biochemistry 2024Quote: ... NEO1 3’UTR was isolated from genomic DNA isolated from cultured HEK-293T using DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final samples of 3 or 30 million cells were collected and genomic DNA was extracted (DNeasy blood and Tissue kit, Qiagen). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting homogenates were centrifuged at 13,000 rotations per minute (rpm) for 3 min and RNA in the supernatant was purified using the RNase Mini Kit (Qiagen). A NanoDrop spectrophotometer was used to measure the concentration of RNA in each sample ...
-
bioRxiv - Immunology 2024Quote: ... was added to each tube and homogenized at 30 rev/s for 3 minutes for 2 rounds using a tissue homogenizer/lyser (#9003240, Qiagen). Kidney extracts were centrifuged at 17,000 RCF for 10 minutes and the supernatant was transferred to a 1.5 mL microcentrifuge tube and kept over ice for 1-2h ...
-
bioRxiv - Pathology 2024Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Genetics 2024Quote: ... yeast plasmid DNA was extracted from 5x107 cells harvested off of galactose and final glucose plates of replicates 2 and 3 using Qiaprep Spin Miniprep Kit (QIAGEN). We amplified the 200-bp repair template region from the initial E ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Genetics 2024Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, pr-set720 and parp-1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... roots or cotyledons) of 3 DAG Arabidopsis seedlings was flash frozen in liquid nitrogen and powdered with TissueLyser machine (Qiagen). RNA was isolated with TRIzol (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... ligated with a single-stranded phosphorylated oligo (to create a 3’-end overhang on template strand) and purified using PCR purification kit (Qiagen). Sequences are listed in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: To determine bispecificity of bsAbs his-tagged HCV E2 (3 μg/mL in Tris-buffered saline (TBS)) was immobilized on NiNTA 96-well plates (Qiagen) for 2h at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were diluted in TE buffer and treated with 1 μL of 20 mg/mL RNAse A (Applichem) for 1 h and 3 μL of Proteinase K (Qiagen) for 2 h at 40C ...
-
bioRxiv - Immunology 2024Quote: Reverse transcription and PCR I were performed in 384-well plates pre-loaded with 3 µL of Vapor-Lock (Qiagen). Cell lysis buffer and reverse transcriptase mix (0.4 µL/well ...
-
bioRxiv - Cell Biology 2024Quote: ... SF was transfected with 12.5 nM antisense LNA GapmeRs CBP (Qiagen, Sequence: 5′-GCG GCG ATC CTT TAG A-3′) or p300 (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... plasmids containing spacer sequences were isolated from 3 mL of overnight culture from each sample with a QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Genomic DNA was extracted from 3 mm rings surrounding the initial punch wound using DNeasy Blood and Tissue kit (Qiagen). The tissues from a pair of ear pinnae from each animal were pooled prior to DNA extraction so that each DNA sample represented one mouse ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from 5,000 sorted melanocytes from 3-4 control or ID1-overexpressing fish per stage using RNeasy Micro Kit (Qiagen, 74004). Ultralow input RNA-seq was performed using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Clontech ...
-
bioRxiv - Biophysics 2024Quote: ... 1.0 mL of culture was extracted from each tube and mixed with 3 mL of RNAprotect Bacteria reagent (Qiagen, Germany) to stabilize cellular RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 50 nM double-stranded siRNA oligonucleotides (Supplementary Table 3) using HiPerFect Transfection Reagent (Qiagen, Crawley, UK).
-
bioRxiv - Immunology 2021Quote: ARNO siRNA (Mm_Pscd2_3) or a negative non-specific siRNA control (Allstar siRNA) were transfected into SFs using HiPerFect transfection reagent (all Qiagen,UK) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...