Labshake search
Citations for Qiagen :
801 - 850 of 2604 citations for Ethyl 5 3R 3 4 dihydroxybutyl thiophene 2 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was added to 3 ml of Ni-nitrilotriacetic acid (NTA) superflow resin (Qiagen) and the mixture was applied onto a gravity drip column ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were mechanically disrupted for 2x 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). This was followed by adding 5 μl of proteinase K (20 mg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted and streaked on LB plates for quantification of colony forming units (CFU ...
-
bioRxiv - Microbiology 2024Quote: ... Demultiplexed raw reads were trimmed for quality and 3’ adaptors using the CLC Genomics Workbench (Qiagen). Reads were mapped to PAO1 ...
-
bioRxiv - Microbiology 2024Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted plated on LB agar plates for quantification of colony forming units (CFU ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 independent PCR reactions were pooled and purified using the QIAquick PCR Purification Kit (Qiagen #28106).
-
bioRxiv - Genomics 2024Quote: Genomic DNA was extracted from 3 × 106 cells using QiaAmp DNA Blood Mini Kits (Qiagen 51104) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplified 3’UTRs were size selected and purified using the QIAquick Gel Extraction kit (Qiagen, #28704) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 μL sample) were run in duplicates in a Rotor-Gene Q machine (QIAGEN) using the appropriate primer pairs.
-
bioRxiv - Neuroscience 2021Quote: ... and 4 were resuspended each in 117 µL of Lysis Buffer RLT Plus (Qiagen), vortexed ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C until DNA preparation using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacture’s recommendation ...
-
bioRxiv - Microbiology 2022Quote: ... the Qiagen MagAttract PowerSoil DNA Isolation Kit (Cat#: 27000-4-KF; Qiagen, Carlsbad, CA), against five other extraction kits ...
-
bioRxiv - Plant Biology 2021Quote: ... and purified with the MiniElute PCR purification kit (QIAGEN, Cat. No. / ID: 28006×4). The purified genomic DNA fragments were end-repaired and had an A-tail added to the 3’ end ...
-
bioRxiv - Molecular Biology 2020Quote: ... thaliana were homogenised with zirconia beads YTZ-4 and TissueLyser II (Qiagen, Hilden, Germany), and total RNA was then extracted using the Maxwell 16 LEV Plant RNA Kit (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was collected and incubated with 4 ml of Ni-NTA agarose (Qiagen) for 2 hours at 4° C ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Immunology 2023Quote: ... Larvae were euthanized at 4°C overnight and homogenized with a tissue lyser (Qiagen) at 1800 oscillations/min (30 Hz ...
-
bioRxiv - Bioengineering 2024Quote: ... and was then subjected to Ni-NTA affinity purification at 4 [(Qiagen, Valencia, CA). The column was adequately washed with 20 column volume of wash buffer containing 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Neuroscience 2023Quote: ... and tissue was homogenized at 4°C in a tissue lyser bead mill (Qiagen) for 2 min at 20 Hz ...
-
bioRxiv - Biophysics 2023Quote: ... 4 °C and the supernatant was loaded onto a NiNTA column (Qiagen, Hilden, Germany) previously equilibrated with washing buffer (20 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Cell Biology 2024Quote: ... treatment or remission serums (n = 4 repeats/condition) using the RNEasy plus kit (Qiagen). Libraries were generated with the KAPA mRNA HyperPrep Kit (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mL were collected and used for plasmid extraction using a QI-Aprep Spin Miniprep kit (QIAGEN). Extracted plasmids were eluted in 30 μL of elution buffer and stored at −20 °C until use.