Labshake search
Citations for Qiagen :
801 - 850 of 1895 citations for 6 Ethyl N N dimethyl 1H pyrrolo 2 3 b pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... total RNA was extracted from the B cells using the RNeasy Mini Kit (Cat. #74004, QIAGEN, Germany) as per the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: Splenic B cells were stimulated as indicated and RNA was isolated using RNeasy Plus Mini Kit (Qiagen). RT-PCR was carried out as described8 using the following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... B cells from an individual experiment were pooled and used to isolate RNA with RNeasy Mini kit (QIAGEN). After treatment with Ambion Turbo DNase ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was isolated from B cells either using Blood and Tissue or Flexigene kits (Qiagen, Hilden, Germany). DNA was quantified with Qubit (ThermoFisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... SPACA6 concentrated to 7 mg mL−1 in Buffer B was mixed in a 1:1 volumetric ratio (0.3:0.3 mL) with JCSG+ (Qiagen), Cryos (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from naïve and cultured B cells using Trizol and RNeasy kit and Dnase treatment (Qiagen) and retro-transcribed to cDNA using random hexamers (Roche ...
-
bioRxiv - Immunology 2020Quote: DAFhi and DAFlo GC B cells (CD19+ CD20+ CD38+ IgD−) were resuspended in RLT cell lysis buffer (Qiagen) after flow cytometric sorting ...
-
bioRxiv - Genetics 2019Quote: DNA was extracted from blood or cell lines using the Puregene Blood Core Kit B (Qiagen, Cat#158467). PCYT1A exons were PCR-amplified from SMD-CRD patient genomic DNA with Accuprime Taq polymerase (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: Total RNA was extracted from FO and MZ B cells using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... ∼12,000-15,000 B cells from the tetramer-enriched fraction were sorted directly into Buffer RLT (Qiagen; Hilden, DE) prior to shipment on dry ice to iRepertoire ...
-
bioRxiv - Physiology 2024Quote: ... using 350 microliter RLT buffer with 1% b-mercaptoethanol as a collection/lysis buffer (RNeasy micro kit, Qiagen). RNA was extracted following manufacturer’s instructions (RNeasy micro kit ...
-
bioRxiv - Molecular Biology 2023Quote: Inhibitors (antimiRs) against miR26b-5p and miR200a/b/c-3p were purchased from Qiagen (339130 and 339160 respectively). AntimiRs in injection media (1mM Tris-HCL pH 7.5 and 0.5 mM EDTA in embryo grade water ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 6 and 9 hours of treatment using RNeasy Plus Mini Kit (Qiagen, 74134), and was reverse-transcribed to cDNA using Transcriptor First Strand cDNA Synthesis Kit with random primers (Roche ...
-
bioRxiv - Genetics 2019Quote: Raw sequence files (FASTQ) were imported into CLC Genomics Workbench (v.6; Qiagen) and mapped onto the human genome (GRCh37/hg19) ...
-
bioRxiv - Biophysics 2020Quote: ... The studies were carried out on a Rotor-Gene Q 6 plex (QIAGEN) instrument at a heating rate of 2 °C/min and a temperature range of 25-90 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 6 dpf larvae (RNeasy Plus Mini Kit; Qiagen) and reversed transcribed (iScript Reverse Transcription Supermix ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The 6 PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) to eliminate byproducts.
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 6-well plates using miRNeasy Mini Kits (QIAGEN 217004) with the inclusion of an on-column DNase digestion (QIAGEN 79254) ...
-
bioRxiv - Bioengineering 2021Quote: ... Four hundred microliters of precipitation buffer B from the Qiagen (Formerly, Exiqon) miRCURY Exosome Isolation Kit (Qiagen, Germantown, MD) was added to the supernatant in each tube ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was discarded and 3.5 ml of RLT buffer with B-mercaptoethanol (10 µl for every 350 µl of RLT buffer – Qiagen) was added ...
-
bioRxiv - Genetics 2020Quote: Total genomic DNA of the tigecycline-resistant isolate was extracted by Puregene Yeast/Bact Kit B (Qiagen, Maryland, US), and was sequenced by using Hiseq 4000 system (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... Gene ontology analyses for high affinity/SHM class-specific GC B cells were performed with Ingenuity Pathway Analysis (Qiagen) software using avg_logFC values of all genes significantly enriched in at least one class ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA from primary B cells treated with sg05 RNPs was isolated using the DNeasy Blood & Tissue Kit (Qiagen) and amplified for sequencing by nested PCR using Platinum SuperFi II Master Mix (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... and GFP+Ly5.1+ (OCA-B-expressing) cells were sorted by FACS and used for RNA purification (RNeasy Mini Kit, QIAGEN). RNA concentrations were determined using a Quant-iT RNA assay kit and a Qubit fluorometer (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... GC B cells (Live/Dead-CD19+IgD-CD95+GL-7+) and naïve B cells (Live/Dead-CD19+IgD+) were flow sorted into RLT Plus buffer (Qiagen) following pre-enrichment with the Pan B Cell Isolation Kit II (Miltenyi) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue from 6 brains were pooled to prepare total RNA (RNEasy micro kit, Qiagen) for reverse transcription and amplification to cDNA (Ovation Pico WTA kit ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmids of 5 µg were transfected into 6x10[6] S2 cells using Effectene (Qiagen) and incubated for 3 days ...
-
bioRxiv - Immunology 2021Quote: ... and harvested for RNA extraction after 6 hours of incubation using RNAeasy kits (Qiagen). cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: HEK293Ts were plated in 6 well plates and transfected using Effectene Transfection Reagent (Qiagen) according the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Immunology 2021Quote: RNA was prepared from sorted GC B cells and LNPCs from FNA or enriched BMPCs from bone marrow using the RNeasy Plus Micro kit (Qiagen). Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNAs of tet(X)-positive isolates were extracted by using Puregene Yeast/Bact Kit B (Qiagen, Gaithersburg, MD, Germany) according to the instruction of the manufacture ...
-
bioRxiv - Microbiology 2022Quote: ... Cytochrome b products were excised and purified from the gel using a commercial kit (QIAquick Gel Extraction Kit, Qiagen, Germany), followed by purification of eluted DNA using AMPure XP Magnetic Beads (1X ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Immunology 2019Quote: ... Two times 2.5 × 105 of naive B cells (CD20+IgM+IgD+IgG−) were sorted and subjected to RNA isolation (RNeasy Micro Kit; Qiagen). Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends ...
-
bioRxiv - Immunology 2020Quote: ... b is the intercept-y of the standard curve and m is the slope of the standard curve (QIAGEN, 2014). Subsequently ...
-
Intrarenal B cells integrate in situ innate and adaptive immunity in human renal allograft rejectionbioRxiv - Immunology 2020Quote: ... and CD45+ Calcein+ DAPI-CD19+ CD38+ activated B cells were single-cell sorted into 96-well plates with catching buffer (RLT lysis buffer (Qiagen) with 1% 2-mercaptoethanol (Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2021Quote: Total RNA from sorted GC B-cells of immunized WT and CD22KO mice was extracted using an RNeasy micro kit (Qiagen). Indexed cDNA libraries were generated using a SMART-Seq Stranded kit (Takara Bio ...
-
bioRxiv - Immunology 2022Quote: 2 × 103 to 1 × 105 sorted B cells per sample were centrifuged at 800g for 8min and total RNA was extracted using RNeasy Micro Kit (Qiagen) following the recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... SEV and CTRL) at endpoints A and B (total of 30 samples) was extracted with QIAamp DNA Blood Mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 2 ml lysis matrix B tubes (MPBio) and subjected to bead beating for 15 min at 30 Hz (Tissuelyser II, Qiagen) with RNAse A added ...