Labshake search
Citations for Qiagen :
801 - 850 of 923 citations for 4 Keto 13 cis retinoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were selected in puromycin (1 μg/ml) the next day and after 4 days genomic DNA was extracted using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was sonicated to an average size of 500 bp using S2 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Pathology 2023Quote: ... tissue and cells were lysed in RIPA lysis buffer supplemented with orthovanadate and a cocktail of protease inhibitors at 4°C (using a TissueLyser (Qiagen) to homogenize liver tissue ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1 h in 50 mL conical tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysates were centrifuged at 10000 g for 30 min at 4 °C and the clear supernatant was collected and passed through Ni-NTA agarose column (Qiagen). Contaminating proteins were washed away by passing a 20–120 mM imidazole gradient through the column while the bound toxins were eluted using PBS containing 500 mM imidazole ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from ciDKO podocytes (3 days after Cre lentiviral transduction) and wild-type control cells (n=4 for each group) using an RNeasy mini kit (Qiagen). RNA was quantified using a Qubit Fluorimeter (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... and then spun down 4 ml of the culture before proceeding to isolation of the final plasmid using a QIAprep Spin Miniprep kit (Qiagen). The samples were stored at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: DNA extraction was carried out from 300 μL culture pellets using the DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4). Subsequent library preparation and sequencing were conducted at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... were immediately placed in RNAlater during dissection and stored at 4 degrees Celsius until RNA isolation using the RNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Culture supernatant containing His-tagged NTD protein was harvested 4 days after transfection and was purified using Ni-NTA resin (Qiagen). Spike protein was further purified with a Superose 6 Increase 10/300 GL column equilibrated with 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was eluted in 100 µL of TE-0.5% SDS buffer with Proteinase K at 60 °C for 4 hours and purified using the MiniElute PCR purification kit (Qiagen).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Digoxigenin (DIG)-labelled probes were denatured at 90°C for 4 min and diluted with 1 x microRNA ISH buffer (Qiagen), following protocol by Endisha & Kapoor ...
-
bioRxiv - Genomics 2024Quote: ... The pooled cells were centrifuged at 500 × g for 5 minutes at 4°C and resuspended in 100 μl of buffer EB (Qiagen).
-
bioRxiv - Immunology 2024Quote: Bladders were weighed and homogenized in 1 mL of sterile PBS at 4°C using a handheld rotor-stator tissue homogenizer (TissueRuptor II, Qiagen). Homogenates were serially diluted ...
-
bioRxiv - Genomics 2024Quote: Ten aphids (n = 10 × 4) were ground to powder with a liquid nitrogen-cooled micropestle after which the RNeasy kit (Qiagen) was used for RNA extraction with on-column DNA digestion (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from 5,000 sorted melanocytes from 3-4 control or ID1-overexpressing fish per stage using RNeasy Micro Kit (Qiagen, 74004). Ultralow input RNA-seq was performed using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Clontech ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was then cleared by centrifugation at 42,000 ξ g for 50 min at 4°C before being applied to 2 mL of Ni-NTA resin (QIAGEN) in a gravity flow column ...
-
bioRxiv - Developmental Biology 2021Quote: ... Luciferase reporter constructs were either mock-treated or methylated in vitro with SssI CpG methyltransferase for 4 h at 37 °C and purified with the QIAquick Purification Kit (QIAGEN 28704). Reporter plasmid (500 ng ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng of plasmid DNA was transfected into each well using Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427). Unless otherwise noted ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Molecular Biology 2021Quote: ... the PCR products were held at 4°C until PCR purification using the QIAquick PCR purification kit (#28106, Qiagen, Hilden, Germany). DNA concentrations were determined using NanoDrop 2000 (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 100μL chloroform were added and samples spun at 7000rpm for 15min at +4°C in a MaXtract column (Qiagen, Venlo, Netherlands). Mixed with 500μL 70% EtOH and spun at 10 000rpm for 30s at +4°C in a MiniElute column ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... The coverslips were then incubated for ~ 10 min with 4 μg/ml of Penta•His biotin conjugate antibody (34440, Qiagen, UK) in reaction buffer [40 mM HEPES buffer (pH 7.3 ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Cancer Biology 2022Quote: ... Variants in variant call format files were evaluated for pathogenicity using Ingenuity Variant Analysis (IVA) version 4 (Qiagen Inc, Alameda, CA) and American College of Medical Genetics and Genomics (ACMGG ...
-
bioRxiv - Microbiology 2022Quote: ... microbial genomic DNA (gDNA) was extracted from possum excreta samples using the DNeasy PowerSoil HTP 96 Kit (Qiagen Cat# 12955-4) following the manufacturer’s protocols just prior to the addition of solution C4 ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of plasmid DNA was transfected into each well using Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427). Unless otherwise noted ...
-
bioRxiv - Plant Biology 2022Quote: ... Samples were centrifuged at 14,000 x g for 20 min (4°C) to pellet insoluble cell debris and supernatants were transferred to violet QIAshredder mini spin columns (Qiagen, Australia) and centrifuged again for one minute ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which we select the top 250 genes for which the correlation coefficient was positive and the top 250 genes for which the correlation coefficient was negative. The final step of the pipeline (Fig. 1 (4)) analyzes these genes by using Ingenuity Pathway Analysis (IPA, QIAGEN, [27]) to interpret the canonical pathways.
-
bioRxiv - Cancer Biology 2024Quote: PC9 and CRUK0764 cells were immediately centrifuged at 300 × g for 4 min to remove supernatant and add 350 µl RLT buffer (Qiagen, 79216) containing 1% β-mercaptoethanol (Sigma ...