Labshake search
Citations for Qiagen :
801 - 850 of 1593 citations for 2 Chloro N 4 chloro 2 2 chlorobenzoyl phenyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: The expressions of 84 innate and adaptive immune genes in the lungs of SARS-CoV-2 infected mice and Sham were determined using RT2 ProfilerTM PCR array kit (Cat#: PAMM-052ZC-24, Qiagen) 39 ...
-
bioRxiv - Genomics 2024Quote: ... were pooled together equimolarly and the final product was purified from a 2% agarose gel with 20 μl silica beads (QIAEX II Gel Extraction Kit, Qiagen). The three random libraries were purified individually ...
-
bioRxiv - Genomics 2024Quote: Frozen tissues were ground in liquid nitrogen using a mortar and pestle or homogenised in 2 mL tubes using a TissueLyzer instrument (Qiagen) immediately prior to DNA extraction ...
-
bioRxiv - Microbiology 2024Quote: ... Faeces was collected in pre-weighed tubes containing 1 ml PBS and homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). Mice were euthanised at indicated time-points ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted from cells harvested at three days or 2 weeks post nucleofection using the RNeasy plus kit (Qiagen) as per the manufacturer’s instructions and quantified by nanodrop ...
-
bioRxiv - Genomics 2024Quote: ... Bxb1 integrase-edited Rep 1 and Rep 2 K562attB gDNA genomic DNA was extracted using DNeasy blood and tissue kit (Qiagen) and samples library preparation and Illumina short read sequencing with a target of 60x genomic coverage ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 8 liver samples (2 from each lobe) were obtained on necropsy and processed with the DNeasy Blood and Tissue Kit (QIAGEN) as per the manufacturer’s instructions to isolate genomic DNA ...
-
bioRxiv - Genetics 2024Quote: ... DNA samples (70–80 oocytes and 7–10 blastocysts per sample) were subjected to bisulfite conversion through 2 µg carrier RNA (QIAGEN). Nested PCR was performed using EpiTaq HS with the primers listed in Supplementary Table 4 ...
-
bioRxiv - Immunology 2024Quote: ... Expression of target ncRNAs in CH12F3 and primary B cells were inhibited by 2 µM miRCURY LNA miRNA Inhibitors (339131, Qiagen), anti-miR-5099 (GGAGCACCACATCGATCTAA-FAM) ...
-
bioRxiv - Immunology 2024Quote: ... Overexpression of miR-5099 in CH12F3 was achieved by transfecting 2 µM of miR-5099 miRCURY LNA miRNA mimic (Qiagen) by electroporation using Lonza 4D-Nucleofector and cell line SF kit following manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... The filtrate was transferred to ultra-clean 2 mL tubes and 280 µL were collected for nucleic acid extraction using the QIAamp Viral RNA mini kit (Qiagen). The extract was eluted in a final volume of 40 µL and stored at -80 °C.
-
bioRxiv - Molecular Biology 2024Quote: ... and HET(2)) and four biological replicates of PA-1 (WT and HET) cells was extracted using miRNeasy Mini Kit (Qiagen) followed by on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was extracted from the mouse blood sampled after feeding the mosquitoes (Barcode input 2) using DNeasy Blood and Tissue Kit (Qiagen). The parasite gDNA was extracted from the infected mosquito midguts 14 days post-infection (Barcode output ...
-
bioRxiv - Plant Biology 2024Quote: ... Reverse transcription of 1–2 μg of RNA for cDNA synthesis was carried out using the Omniscript RT Kit (Qiagen).
-
bioRxiv - Neuroscience 2024Quote: Cortical brain tissue was homogenised in TBS (with cOmplete mini protease inhibitor cocktail) for 2 minutes at 200 Hz using Tissue Lyser II (Qiagen), centrifuged at 31,000 g for 1 hour at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... weighed and homogenized 1:180 (weight:volume, mg:µL) in homogenization buffer (50 mM Triethanolamine and l mM EDTA) with 2 tungsten beads (Qiagen, Cat. #69997) using a Tissue Lyser (Qiagen Cat ...
-
bioRxiv - Neuroscience 2024Quote: BV-2 cells and primary mouse astrocytes were harvested and RNAs were extracted using the RNeasy Kit (Qiagen, Hilden, Germany) following the manufacturer’s directions ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments were separated on a 2% agarose gel and fragments from 600-800 base pairs were isolated using the QIAquick Gel Purification Kit (Qiagen). Fragments were then amplified by 15 cycles of PCR and sequenced using Illumina sequencing at the Tufts Core Facility (Boston ...
-
bioRxiv - Synthetic Biology 2024Quote: ... two small lab spoons (5 mm) of biomass were transferred to a 2 mL screw cap tube with a steel bead inside (5 mm; Qiagen) and frozen using liquid nitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... The final pools were purified from a 2% agarose gel using a silica beads extraction kit (QIAEX II Gel Extraction Kit, Qiagen).
-
bioRxiv - Biochemistry 2024Quote: ... Eluted complex was then mixed to 6 μL of 5 M NaCl and 2 μL of 100 mg/mL RNase A (Qiagen) and incubated overnight at 65°C to reverse cross-linking and digest RNA ...
-
bioRxiv - Genetics 2024Quote: ... which was then homogenized in a 2 mL tube containing a sterile glass bead using a TissueLyser (QIAGEN, Aarhus, Denmark) in two cycles at 30 Hz for 30 seconds ...
-
bioRxiv - Genetics 2024Quote: ... 20 µM of Illumina primers and 1:2000 dilution of 2 ng/µl library on Rotor-Gene Q machines (Qiagen), program and primer sequences are in Table) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... For DNA extraction approximately 2 mm3 of wing muscle tissue was removed from the thorax and processed using DNeasy Blood and Tissue Kits (Qiagen) following standard manufacture protocols ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... for 20 min at 37 °C (2 units per sample) was followed by purification using the RNeasy minElute Cleanup kit (Qiagen). RNA quality of all samples was checked using the Agilent 2100 Bioanalyzer with an Agilent RNA 6000 Nano Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or CRTC3 or control sgRNA (Supplementary Table 2) were transfected into 293FT cells together with packaging plasmids pMD2.G and pSPAX2 using Effectene transfection reagent (Qiagen #301425). The viral supernatants were collected at 48 ...
-
bioRxiv - Genomics 2021Quote: ... The samples were then transferred to RNeasy spin columns and 2 ml collection tubes from an RNeasy Mini Kit (Qiagen, 74104) and centrifuged at 13,000 rpm for 15 sec ...
-
bioRxiv - Genomics 2022Quote: Buccal swab samples were placed in 2 mL Eppendorf tubes and were extracted using a modified version of the DNeasy® Blood and Tissue Kit (Qiagen). In each tube were added 380 μL of ATL Buffer and 20 μL of Proteinase K (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... The clinical Samples (cervical smear) for the HPV DNA test were processed using HPV Test Hybrid Capture® 2 protocol (QIAGEN). Samples with relative light units (RLU ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from a minimum of 2 × 106 sorted MDSCs or nonMDSCs using an RNAeasy Mini Kit (Qiagen, Germantown, MD). RNA sequencing was performed by GENEWIZ (South Palinfield ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Epidemiology 2020Quote: ... Then a steel ball was added and samples were crushed twice during 2 min at 30 Hz/s with the Tissue Lyzer (Qiagen, Germany). 450 µL of fresh PBS 1X were added to the samples ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from 2 g of homogenized material from frozen needles using the DNeasy Plant Maxi Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...