Labshake search
Citations for Qiagen :
801 - 850 of 2928 citations for 1 Piperidineacetamide 4 2 benzothiazolyl N 4 4 morpholinyl phenyl 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from batches of embryos, ICM or TE (n = 20) using PicoPur Arcturus (Excilone, France) with a DNase I (Qiagen, Germany) treatment as recommended by the supplier ...
-
bioRxiv - Neuroscience 2020Quote: ... RAGE-/- and SOD1G93A x RAGE-/- mice (n = 5 - 6) using RNeasy Lipid Tissue extraction kit according to manufacturer’s instructions (QIAGEN, CA, USA). The total RNA was purified from genomic DNA contamination using Turbo DNase treatment (Ambion ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground inside a microtube with a stainless steel pestle until finely powdered and a N-phenacylthiazolium bromide (PTB) and Qiagen Plant DNEasy® Mini Kit (Qiagen)-based protocol was used to isolate the DNA18 ...
-
bioRxiv - Cancer Biology 2021Quote: ... normal tissue or n=30 embryos at 20 hours post fertilization was used as input to the RT2 HT First Strand Kit (Qiagen #330411) to reverse transcribe cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and organoids at the end of passage one subjected to two weeks of differentiation (n=3) using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from the colon tissue of mice (n=5) by using the RNeasy mini kit (Cat# 74104, Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from hippocampus samples (n=6 per group) was extracted using RNABle lysis reagent (Eurobio) and the RNeasy® Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: RNA extraction was performed on N=31 homogenized half-brain tissue aliquots using the RNeasy Plus Micro Kit (QIAGEN, Germantown, MD). Tissue aliquots were homogenized in 350 µl QIAGEN Buffer RLT Plus using a Qiagen TissueLyser LT and centrifuged for 3 min at maximum speed ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from FFPE tumor cores (n= 12 samples) using RNeasy FFPE kits according to the manufacturer’s protocol (QIAGEN, Germantown, MD). RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from initial and exponential growth phase cultures grown on different N sources using a DNeasy PowerSoil Pro DNA isolation kit (QIAGEN, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Total DNA was extracted from mouse parotid gland tissue (n=5/group) following the manufacturer’s protocol for DNeasy Blood & Tissue Kit (Ref. No. 69504, Qiagen, Hilden, Germany). Mitochondrial DNA (mtDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and GSC6-27 HEPACAM shRNA (n=3) cultures were washed in cold 1X PBS and total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, 74134) following manufacturer’s guidelines ...
-
bioRxiv - Physiology 2022Quote: ... liver and eWAT samples (n=6 per group) were extracted using RNABle lysis reagent (Eurobio) and the RNeasy® Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from each sample (n=3 WT and n = 3 Fgf9null) using Trizol/chloroform and spin-column assembly with on-column DNase treatment (RNeasy mini kits; Qiagen Germantown, MD). We assessed the quality of RNA using fragment analysis to obtain RNA integrity number (RIN ...
-
bioRxiv - Neuroscience 2020Quote: ... from APP/PS1 and NTG mice treated with vehicle of CP2 for 14 months (n = 5 per group) were lysed in QIAzol (Qiagen cat. # 79306) followed by RNA isolation using miRNeasy (Qiagen cat ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was isolated from snap-frozen cortico-hippocampal brain sections from NTG and APP/PS1 mice treated with vehicle or CP2 (n = 5 per group) for 14 months using a DNeasy Blood & Tissue Kit (QIAGEN, cat. # 69504) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: DNA was individually extracted from the head and abdomen of all mosquito specimens (n=112) using the QIAamp DNA tissue extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... was extracted from the blood (N. scutatus) or tail clip (P. textilis) using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with proteinase K (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... and AR DBD domain DNA fragment were cut by NheI (N-terminal) and XhoI (C-terminal) and purified with the QIAquick Gel Extraction Kit (Qiagen; cat. 28704). After ligation with T4 DNA Ligase (New England ...
-
bioRxiv - Molecular Biology 2023Quote: Parotid glands were removed from mice (n=5/group) and total DNA was immediately isolated using the DNeasy Blood & Tissue Kit (Ref. No. 69504, Qiagen, Hilden, Germany). DNA samples were diluted with nuclease-free water to a concentration of 10 ng/uL ...
-
bioRxiv - Physiology 2023Quote: Total RNA and miRNA was extracted from liver and distal intestine (n = 6 per condition) using a miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen, Hilden, Germany) following the protocol provided by the manufacturer ...
-
bioRxiv - Physiology 2023Quote: ... proximal intestine and distal intestine (n = 6 per sampling day and diet) according to the miRNeasy Tissue/Cells Advanced Mini Kit protocol (Qiagen, Hilden, Germany). RNA was treated with the Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... E17 and P0 (n=6 embryos per sex and time point) using the Qiagen miRNeasy mini kit (CatNo. 217004; Qiagen; Hilden, Germany). 500 ng of total RNA ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Molecular Biology 2024Quote: ... Frozen tumor cryosections were homogenized with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Systems Biology 2024Quote: ... K56-2 pcepI-lux and K56-2 ΔcciIR pcepI-lux was extracted using the DNeasy UltraClean Microbial Kit (Qiagen S.r.l). Whole genome shotgun sequencing (2 x 150 bp ...
-
bioRxiv - Genomics 2024Quote: ... Frozen lung cryosections were homogenised with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...