Labshake search
Citations for Qiagen :
8401 - 8450 of 10000+ citations for Mouse Activation Induced Cytidine Deaminase AICDA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... Amplicons were PCR-purified using the QIAquick PCR Purification Kit (Qiagen), and subsequently labeled using the BioPrime DNA Labeling System (Invitrogen) ...
-
bioRxiv - Genomics 2019Quote: ... DNA was purified using a MinElute PCR purification kit (Qiagen #28004) and libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (NEB #E7645S) ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using the DNA blood and tissue kit (Qiagen) followed by phage and Curvibacter sp ...
-
bioRxiv - Genetics 2019Quote: ... Total mRNA was extracted using RNeasy Plus Mini Kit (QIAGEN, 74134) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: We extracted DNA following a modified DNeasy PowerSoil Kit (Qiagen Inc.) protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR was carried out using QuantiFast SYBR Green PCR Kit (Qiagen) or SYBR Green PCR Master Mix (Applied Biosystems) ...
-
DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cellsbioRxiv - Synthetic Biology 2019Quote: Genomic DNA was extracted with the QIAmp DNA Micro Kit (Qiagen) and carrier RNA (for Figure S4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and total RNA was extracted using a miRNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: RNA extraction was done with RNeasy® Plus Micro Kit (Qiagen) according to the protocol ...
-
bioRxiv - Immunology 2019Quote: ... Total mRNA was extracted using RNeasy Plus Mini Kit (Qiagen #74104). RNAseq was performed at The Center for Medical Genomics at Indiana University School of Medicine ...
-
bioRxiv - Microbiology 2019Quote: ... we extracted genomic DNA with the MO Bio PowerFecal kit (Qiagen) automated for high throughput on QiaCube (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... RNA was reverse transcribed using Quatitect Reverse Transcription Kit (Qiagen 205313). Quantitative PCR analysis was performed using SYBR Green Quantitative PCR Master Mix (Roche 0692404001 ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified with the use of a QIAquick Gel Extraction Kit (Qiagen), and sequenced ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was purified from the lysate using RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was isolated by RNeasy Micro or RNeasy Mini kits (Qiagen) followed by cDNA synthesis using the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific).
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was extracted using the RNeasy mini kit buffers (Qiagen) and purified on RNA-binding spin columns (Epoch) ...
-
bioRxiv - Microbiology 2019Quote: ... ChIPed DNA was purified using a PCR clean up kit (Qiagen). For input samples (an aliquot of the sonicated ...
-
bioRxiv - Physiology 2019Quote: ... and RNA samples were purified using the miRNeasy kit (#1038703, Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using random and HAstV1-specific reverse primers ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA transcripts were purified using the RNeasy mini kit (QIAGEN), eluted with RNAse-free sterile water and stored at −80°C prior to use.
-
bioRxiv - Developmental Biology 2019Quote: ... RNA was extracted from individual samples using RNAeasy Micro Kit (QIAGEN). For RNA-seq ...
-
bioRxiv - Developmental Biology 2019Quote: ... The two supernatants were combined and purified with MinElute kit (Qiagen) in 22µl of EB buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... DNA was isolated from blastocysts using the QIAamp Investigator Kit (Qiagen), eluting in 23 uL of nuclease-free water ...
-
bioRxiv - Neuroscience 2019Quote: ... Complementary DNA was synthesized by using the Omniscript RT Kit (Qiagen) or SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... and RNA extraction (TRIzol, ThermoFisher Scientific and RNeasy mini kit, Qiagen).
-
bioRxiv - Immunology 2019Quote: RNA from sorted cells was extracted using RNeasy micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse transcription was performed using the Quantitect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... and cleaned using the QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany). Samples were sent to Eurofins Genomics (Eurofins Genomics Co. ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from embryos using RNeasy Mini Kit (Qiagen), and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Microbiology 2019Quote: ... and were then treated with the RNeasy MinElute Cleanup Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... Mitochondria isolation was performed using the Qproteome Mitochondria isolation kit (Qiagen). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA over 200 nt was first isolated using RNeasy kit (Qiagen). Subsequently ...
-
bioRxiv - Immunology 2019Quote: ... Total RNA was extracted by column purification (Qiagen RNeasy Mini Kit). RNA was sent to the Vincent J ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... whole genome amplification was performed using REPLI-g Mini kit (Qiagen) due to the low concentrations of gDNA ...
-
bioRxiv - Bioengineering 2019Quote: ... genomic DNA was extracted using DNAeasy Blood and tissue kit (Qiagen). To tested if translocation created chimeric chromosomes containing both CRISPR LiveFISH labeled Chr3 and Chr13 loci ...
-
bioRxiv - Biochemistry 2021Quote: Mammalian cells: RNA was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... All post-reaction purifications utilized the MinElute PCR Purification Kit (Qiagen).
-
bioRxiv - Pathology 2021Quote: ... using QuantiTect SYBR Green RT-PCR Kit and QuantiTect Primers (Qiagen). Three housekeeping gene mRNAs (GAPDH ...
-
bioRxiv - Genomics 2021Quote: ... and cleaned up with the RNeasy Mini Kit (Qiagen, Venlo, Netherlands). Accumulibacter clade quantification was performed on biomass samples collected on the same day of the metatranscriptomics experiment using clade-specific ppk1 qPCR primers as described by Camejo et al ...
-
bioRxiv - Genomics 2019Quote: ... The final library was purified using a Qiagen MinElute kit (Qiagen) and Ampure XP beads (Ampure ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using a Puregene Tissue Core Kit B (Qiagen).
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using a QIAquick PCR Purification Kit (Qiagen) and each gene was inserted into an entry vector (pDONR222 ...
-
bioRxiv - Genetics 2020Quote: ... verified by sequencing and purified with a Plasmid Midi kit (Qiagen).
-
bioRxiv - Genetics 2020Quote: ... The eluted DNA was purified with MinElute PCR purification kit (Qiagen) and analyzed by qPCR or NovaSeq (150bp paired-end ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) and the NEXTFLEXTM Rapid DNA-seq Kit (NOVA-5114-03 and NOVA-5144-04 ...
-
bioRxiv - Immunology 2021Quote: RNA from cells was obtained using the RNA Easy Kit (Qiagen) incorporating the DNAse I step to remove contaminating genomic DNA ...
-
bioRxiv - Genomics 2021Quote: ... then total RNA was extracted with RNeasy Mini Kit (Qiagen, Tokyo) (n=6 for control and treated respectively) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated using the miRNeasy mini kit (Qiagen #217004) according to the manufacturer’s instructions ...