Labshake search
Citations for Qiagen :
8101 - 8150 of 10000+ citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Amplified DNA was purified using Qiagen MinElute Kit (Qiagen, 28004). A size-selection of libraries was performed using SPRIselect beads (Beckman ...
-
bioRxiv - Developmental Biology 2023Quote: RNA extraction was done using RNeasy mini kit (Qiagen, Germany). cDNA was synthesized using High Capacity cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then extracted with the Puregene DNA Kit (Qiagen) per the manufacturer’s protocol for tissues ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... then purified using the QIAquick PCR Purification Kit (Qiagen, 28106). The eluent was split into 3 tubes for the subsequent second step PCR ...
-
bioRxiv - Cancer Biology 2022Quote: RNA extractions were performed using the RNeasy kit (QIAGEN 74106) and the QIAshredder spin columns (QIAGEN 79656) ...
-
bioRxiv - Immunology 2023Quote: ... and total RNA was isolated using RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA was extracted using RNeasy® Mini kit (Qiagen). RNA was quantified on a Nanodrop ND-100 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Trace DNA was digested using the DNase Max Kit (Qiagen). RNA quantity and integrity was confirmed with nanodrop (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using a PCR purification kit (Cat# 28104, Qiagen). ChIP-seq libraries were made using the MicroPlex Library Preparation kit V2 (C05010012 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was then extracted using the RNeasy Mini Kit (Qiagen) as per manufacturer directions from three biological replicates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using a forward primer (GGCAAACAACAGATGGCTGGCAAC ...
-
bioRxiv - Genomics 2023Quote: ... followed by purification with the Qiagen RNeasy kit (Qiagen, USA). RNA was harvested using Rneasy mini plus kit (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... RNA was harvested using Rneasy mini plus kit (Qiagen, USA). 2 ug of total RNA was used for the construction of sequencing libraries ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Qiagen miRNEasy Mini Kit (Qiagen, #217004) according to manufacture instructions ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was extracted using the RNeasy Mini Kit (Qiagen) from the heads and bodies of 15 days old D ...
-
bioRxiv - Microbiology 2023Quote: ... and further purified using the DNeasy PowerClean CleanUp kit (QIAGEN). Consequently ...
-
ENGRAILED-1 transcription factor has a paracrine neurotrophic activity on adult spinal α-motoneuronsbioRxiv - Neuroscience 2023Quote: ... and reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen). RT-qPCR was done using SYBR-Green (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was purified from Ishikawa cells using RNeasy kit (Qiagen). RNA quality was evaluated using a Bioanalyzer 2100 (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... followed by column purification per manufacturer’s recommendation (Qiagen, Minelute Kit). DNA was eluted from the columns in 22ul H2O ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... polygyrus adult nematodes was isolated using the miRNAeasy kit (Qiagen) and visualized on a bioanalyzer (RIN > 7.0 ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted with Qiagen Blood and Tissue Kit (Qiagen), PCR was carried out with primer targeting pos ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA extraction was performed using RNeasy Micro RNA kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA extraction was performed using RNeasy Micro RNA kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR cleanup/gel extraction kits (Qiagen or IBI-MidSci) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted using the RNeasy Mini kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted using the RNeasy Mini Kit (Qiagen) and treated with the RNase-Free DNase Set (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using the RNeasy Micro kit (Qiagen). RNA was hybridized to the Affymetrix Mouse 1.1 ST genechip at the Ramaciotti Centre for Gene Function Analysis at the University of New South Wales ...
-
bioRxiv - Cell Biology 2023Quote: ... and purified with the RNeasy MinElute Cleanup Kit (QIAGEN, #74204). mRNA was injected into embryos at the 1-cell stage in the following amounts ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids were amplified with the QIAprep Spin miniprep kit (Qiagen) and linearized with Not1-HF (New England Biolabs) ...
-
bioRxiv - Immunology 2022Quote: ... RNA-Isolation was performed using the RNeasy Micro Kit (Qiagen) on a QiaCube (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the QIAamp DNA Blood Maxi kit (Qiagen, Cat # 51192). Genomic DNA was amplified for Illumina sequencing using sgRNA library primers as described previously16 and was sequenced on the HiSeq2500 platform with 31 bp paired-end reads ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted using the DNeasy Plant Mini Kit (Qiagen). Libraries preparation and sequencing were performed by Novogene LTD (UK) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted using the RNeasy Micro Kit (Qiagen) and reverse transcribed using the Reverse Transcription System (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... and subsequently purified using a QIAquick PCR Purification Kit (Qiagen). Single-stranded RNA was generated from each DNA template using a MEGAscriptTM T3 and T7 Transcription Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: Genomic DNA was isolated using QIAamp DNA Micro Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and purified using the RNeasy mini kit (Qiagen, Germantown, MD) according to manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: Total RNA from tissues was isolated RNeasy Mini Kit (Qiagen). RNA was reverse-transcribed into cDNA using ImProm-II™ Reverse Transcription System (Promega ...
-
bioRxiv - Synthetic Biology 2023Quote: ... QIAprep Spin Miniprep Kit was purchased from Qiagen (Valencia, CA), and Zymoclean Gel DNA Recovery Kit and Zymoprep Yeast Plasmid Miniprep Kits were purchased from Zymo Research (Irvine ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted using the RNeasy Mini kit (Qiagen) according to manufacturer’s instructions and quantified using a Nanodrop UV-Vis Spectrophotometer (Thermofisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was extracted using a GeneRead DNA FFPE Kit (Qiagen) and RNA was extracted using a RNeasy FFPE Kit (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated using the RNeasy Micro Kit (Qiagen, 74004) and reverse transcribed using iScript cDNA synthesis kit (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was isolated with the RNeasy Micro kit (Qiagen) from 2,000 to 3,000 cells and then subjected to bulk RNA sequencing.
-
bioRxiv - Bioengineering 2023Quote: ... and total RNA was isolated by RNeasy mini kit (Qiagen) and reverse transcribed by iScript cDNA synthesis kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA was extracted using a RNeasy FFPE Kit (Qiagen) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated using RNeasy Mini Kit (QIAGEN Sciences) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids were isolated using a bacterial miniprep kit (Qiagen, 27106). Nanobody sequences were determined by Sanger sequencing.
-
bioRxiv - Physiology 2023Quote: ... DNA fragments were purified using QIAquick PCR purification kit (Qiagen). For ChIP ...
-
bioRxiv - Neuroscience 2023Quote: ... libraries were purified with the MinElute PCR Purification kit (Qiagen). Library quality was determined with the Bioanalyzer High-Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were purified with the QIAquick PCR Purification kit (QIAGEN) followed by the Agencourt AMPure XP reagent (Beckman Coulter) ...
-
bioRxiv - Genetics 2023Quote: ... for faecal samples and the QIAamp DNA Investigator Kit (Qiagen) for all other non-invasive sample types ...