Labshake search
Citations for Qiagen :
751 - 800 of 1142 citations for lefty A TGF beta 4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... total RNA was harvested from BMDM 4 hours post-treatment per Qiagen RNA extraction protocol (QIAGEN). RNA was then reverse transcribed to cDNA using iScript Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human U6 primer used in this experiment was included in the miScript Primer assay kit (Qiagen Inc., Germantown, MD, #218300).
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Developmental Biology 2021Quote: ... The expression levels of the mRNAs were quantified using Human Embryonic Stem Cell RT2 Profile™ PCR Array (Cat. PAHS-081, Qiagen) and RT2 SYBR Green qPCR Master Mix (Cat ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from a 23 week human fetal heart using Trizol-based dissociation followed by the RNEasy Mini Kit (Qiagen #74104). cDNA was created from this RNA using the iScript Reverse Transcription Supermix (Bio-Rad #1708840) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was isolated from human buffy coat samples at the Crimson Core facility (Mass General Brigham) using the QIAamp DNA Blood Mini Kit (Qiagen 69504) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Reference plasmids were serially diluted in either PBS buffer or heat-inactivated normal human serum (NHS) and re-extracted using the QIAamp® DNA Blood Mini Kit (Qiagen) per recommended protocol for serum ...
-
bioRxiv - Cancer Biology 2020Quote: Flag-tagged NF1-GRD (aminoacids 1131-1534) was amplified by PCR from human cortical tissue (epilepsy patient) and first cloned in the pDRIVE vector (Qiagen #231124). Primers are listed in Supplementary Table 5 ...
-
bioRxiv - Immunology 2021Quote: ... and ImmunoCult™ Human Treg Differentiation Supplement (StemCell TechnoRNA was isolated at set time points after activation using the RNeasy Mini (Qiagen). cDNA was generated using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted from human cell lines of WI-38 and MED13LS1497F using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... 1 µg of RNA isolated from human islets or 10 µL of exosomal RNA was reverse transcribed using the miRScript II kit (Qiagen, Germany), following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... RT PCR was performed on a Roche LightCycler 96 using the The RT² Profiler™ PCR Array Human Cell Death PathwayFinder (PAHS-212Z, Qiagen)w ...
-
bioRxiv - Neuroscience 2023Quote: ... The association of the differentially expressed proteins with specifically dysregulated regulatory/metabolic networks in OT human samples was analyzed using QIAGEN’s Ingenuity Pathway Analysis (IPA; QIAGEN Redwood City). This software calculates significance values (p-values ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Four 2-mL aliquots of culture were thoroughly mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) and incubated at room temperature for 5 min before centrifugation at 4,000 × g for 12 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed 4 times with 1 ml of IP buffer and 700 μl of Qiazol (Qiagen) was directly added to the beads ...
-
bioRxiv - Physiology 2020Quote: ... DNA was isolated using Qiagen MagAttract PowerMicrobiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) on the EpMotion 5075 (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Microbiology 2020Quote: ... The soluble fraction was incubated for 1 hour at 4 °C using a Ni-NTA resin (Qiagen). The Ni-NTA resin was washed with 4 times resin volume (RV ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from 4 mg of ground lyophilized material using the RNeasy Midi kit (Qiagen). A DNase treatment (Ambion ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated for ~2 h rotating at 4°C with Ni-NTA Resin (Qiagen, 1018244) that had been washed with wash buffer (20mM Tris HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2022Quote: Cell pellets or pieces of xenografts were lysed in 4% SDS buffer using a QIAshredder (Qiagen, 79654). See Supplementary Table S1 for antibodies used ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from 4×107 KPC cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen). NGS libraries were prepared using the following primers:
-
bioRxiv - Microbiology 2020Quote: ... RNA extraction was performed from homogenate of 4 mg of lung tissue with RNeasy Mini Kit (Qiagen), or 50µl of serum using the NucleoSpin kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2022Quote: ... 97-mer shRNA oligonucleotides were synthesized (IDT) and 4 picomoles were amplified with HotStarTaq polymerase (Qiagen#203207) using the primers miR-E-fw (5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ ...
-
bioRxiv - Pathology 2021Quote: ... at 4°C and total RNA was extracted with the RNeasy Midi kit (Qiagen, Santa Clarita, CA). Mouse Genome 430A 2.0 arrays (Affymetrix ...
-
bioRxiv - Systems Biology 2019Quote: ... n=4/group/strain for hypothalamus) using All-Prep DNA/RNA/miRNA Universal Kit (Qiagen, CA. USA). mWAT was chosen due to its stronger implications in MetS than other fat depots (14) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were kept at 4° for two days before extracting DNA using the DNeasy PowerSoil Kit (Qiagen). We also obtained DNA extracted from ...