Labshake search
Citations for Qiagen :
751 - 800 of 5763 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Following DNAse treatment with RNase-Free DNase Set (Qiagen), RNA concentration and purity were assessed by Nanodrop 2000 spectrophotometer (Thermo Scientific™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× QuantiNova RT Mix (Qiagen), 1× QuantiNova SYBR Green RT-PCR Master mix ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized by Qiagen Omniscript RT Kit (#205111, Qiagen). RT-qPCR was performed using QuantiTect SYBR® Green PCR Kit (#204145 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was synthesized by Qiagen Omniscript RT Kit (#205111, Qiagen). RT-qPCR was performed by using QuantiTect SYBR® Green PCR Kit (#204145 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was synthesized by Qiagen Omniscript RT Kit (205111, Qiagen). The relative mRNA level of indicated genes was normalized to that of the internal control Hsp90 and calculated by the equation 2^(Ct(cycle threshold ...
-
bioRxiv - Bioengineering 2019Quote: ... Sensiscript RT Kit (QIAGEN, Germany) was used for cDNA synthesis with 50 ng per reaction according to the manufacturers’ instructions ...
-
bioRxiv - Genetics 2020Quote: ... with RT² SYBR Green (Qiagen), POWER SYBR (Thermo Fisher) ...
-
bioRxiv - Genetics 2022Quote: ... miScript II RT Kit (Qiagen) was used to synthesize cDNA ...
-
bioRxiv - Genomics 2021Quote: ... the detection of N-gene of SARS-CoV-2 was performed by using the 2019-nCoV-2 RUO kit (Integrated DNA Technologies, Inc., Coralville, Iowa, USA) and One-Step RT-PCR Kit (QIAGEN® GmbH) on a Rotor-Gene Q real-time PCR cycler (QIAGEN® GmbH) ...
-
bioRxiv - Microbiology 2022Quote: ... Correct introduction of the NS1 mutations was verified via cDNA synthesis of viral RNA using the One-Step RT-PCR kit (Qiagen, Hilden, Germany), amplification and sequencing using NS-specific primers ...
-
bioRxiv - Immunology 2020Quote: RNA from B1a B cells was reverse transcribed and amplified using a Qiagen OneStep RT-PCR kit (Qiagen Inc., Valencia, CA, USA) and iRepertoire® mouse BCR heavy chain (MBHI ...
-
bioRxiv - Microbiology 2020Quote: ... an aliquot of the extracted RNA solution was added to the reaction mixture for the QuantiTect probe RT-PCR kit (Qiagen, Hilden, Germany), which contained 2x QuantiTect probe RT-PCR master mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and the resulting cDNA was used for reverse transcription-polymerase chain reaction (RT-PCR) using HotStarTaq Plus Master Mix Kit (Qiagen, Germantown, MD). The PCR conditions used were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT2 qPCR Primer assays for GAPDH and primers for target genes were respectively purchased from Qiagen and IDT ...
-
bioRxiv - Developmental Biology 2019Quote: ... Primers sequences are shown in Extended data table 2 and predesigned quantitech primer assays (Qiagen, 249900) were used for other genes including Gal (QT00109970) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR reactions were run using a QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotorgene Q ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR reactions were run using the QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotor-Gene Q ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 20 mM of each primer (KAN-2 FP1 or KAN-2 RP1 complementary to the Tn5 sequence with the bubble primer 224) and 10 μL of the 10X Qiagen Multiplex PCR Master Mix Kit (Qiagen, Valencia, CA, USA) in a final volume of 100 μL ...
-
bioRxiv - Plant Biology 2022Quote: ... All qPCR reactions were performed with primer concentrations at a final concentration of 250 nM in a Rotor-Gene Q real-time PCR cycler (Qiagen, Q-Rex v1.0), using the Rotor-Gene SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... 4 μL PCR mastermix (made up of 0.75 μl at a concentration of 0.2 μM of each primer, 80 μl ultrapure water, and 250 μl QIAGEN Multiplex PCR mix; QIAGEN Inc. Cat. No. 20614). PCR conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR was performed on 40 pg cDNA using specific primers (Supplementary Table 1) and miRCURY® LNA® miRNA SYBR® Green PCR (Qiagen). Values were normalized to miRNA quantity and expressed as relative expression to control WS using formulae 2−ΔCT.
-
bioRxiv - Cancer Biology 2021Quote: ... using predesigned Quanititect Primer assays (Qiagen) to the following murine genes ...
-
bioRxiv - Molecular Biology 2021Quote: ... and QuantiTect primer assays (Qiagen, 249900) that were used for lncRNA and mRNA expression analysis are listed in Additional file 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following miScript Primer Assays (Qiagen) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... The following qPCR primers from Qiagen were used ...
-
bioRxiv - Systems Biology 2020Quote: ... Primers used were ordered from Qiagen, including GATA4 (QT00031997) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The RT2 qPCR primer assays (Qiagen) or qPCR primers (IDT ...
-
bioRxiv - Cancer Biology 2019Quote: ... We purchased all primers from Qiagen, collected raw data and analyzed levels of relative mRNA expression with 2-ΔΔCt method ...
-
bioRxiv - Cancer Biology 2022Quote: ... The primers were: Hs_AREG (Qiagen; #QT00030772); Hs_PIDD1 (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Immunology 2021Quote: ... and random hexamer primers (Qiagen, 79236) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Cell Biology 2021Quote: ... All primers were purchased from Qiagen website ...
-
bioRxiv - Cell Biology 2020Quote: ... Predesigned QuantiTect® Primer Assays (Qiagen) were used for all genes ...
-
bioRxiv - Physiology 2022Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Developmental Biology 2023Quote: ... ilp8 primers used from Qiagen (QT00510552), dmyc forward primer (AACGATATGGTGGACGATGG) ...
-
bioRxiv - Biochemistry 2023Quote: ... The U6 snRNA primer from Qiagen was used for normalization ...
-
bioRxiv - Cell Biology 2023Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Molecular Biology 2023Quote: ... we purchased commercial primers from Qiagen. Primers for mouse Sprr1a (GeneCopoeia ...
-
bioRxiv - Immunology 2023Quote: ... Pre-synthesized QuantiTect primers from Qiagen were used for il12b ...
-
bioRxiv - Molecular Biology 2024Quote: ... Validated primers were obtained from Qiagen, UK for the miRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from a 10 mL culture using the QIAGEN® Genomic DNA Buffer Set and Genomic-tips™ 100/G set (midi-prep) (QIAGEN, Hilden, Germany). This procedure adhered to the Sample Preparation and Lysis Protocol for Bacteria as outlined in the QIAGEN® Genomic DNA Handbook ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of the template was used in a 25 μL reaction using the QuantiFast Probe RT-PCR Kit (Qiagen, Inc., Valencia, CA) with 0.4 μM of each primer and 0.2 μM probe ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (200 ng) was reverse-transcribed in cDNA and amplified by using QuantiNova SYBR Green RT-PCR kit (QIAGEN®, Hilden, Germany). Viral genomes were extracted from the supernatants at different time points post-infection using Takara MiniBEST Viral RNA/DNA (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR reactions for each primer set were performed on RNA (50-75 ng/ul) from at least two biological replicates of the mutant allele and control (QIAGEN OneStep RT-PCR Kit, QIAGEN Inc., Cat # 210212). The bounds of where transcriptional termination and initiation occurs within Mu for each mutant allele was determined by presence of amplification from gDNA and absence of amplification from cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... To profile the expression of genes related to p53-mediated signal transduction based on the RT² Profiler™ PCR Array Human p53 Signaling Pathway (#330231, PAHS-027ZC, Qiagen, Hilden, Germany), reverse transcription and qPCR were performed using the RT2 First Strand Kit (#330401 ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was treated with DNase (DNase-Free DNase Set, Qiagen) and repurified using the miRNeasy micro plus Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Residual DNA was eliminated using RNAse-Free DNase Set (Qiagen). Sorted nuclei were pelleted before proceeding with downstream RNA isolation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and DNAse-treated with the RNAse-free DNAse Set (QIAGEN). Samples were reverse transcribed using the TaqMan Reverse Transcription Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and DNase-treated with the RNase-Free DNase Set (Qiagen). RNA was quantified using Qubit Fluorometric Quantitation (Life Technologies) ...