Labshake search
Citations for Qiagen :
751 - 800 of 1199 citations for N6 2 aminoethyl 9H purine 2 6 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Approximately 1 μg of small RNAs in 8.5 μl were incubated with 2 μl of QIAseq FastSelect –rRNA Yeast Kit (Qiagen, #334215) at 75°C ...
-
bioRxiv - Immunology 2023Quote: Purified CD4+FYP+ Treg cells were stimulated with Cell Stimulation Cocktail (eBioscience) for 2 hrs and lysed in RLT buffer (Qiagen) containing 1% 2-mercaptoethanol (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... the eluted DNA samples were run on a 2% agarose gel and the 280bp band purified using the QIAquick Gel extraction kit (QIAGEN). Illumina libraries were generated from 10 ng of DNA ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The supernatant was then purified using a modified PB buffer and eluted using 2 washes in 18 μl buffer EB (QIAGEN) - with 3 min of incubation time at 37°C (Dabney et al ...
-
bioRxiv - Genetics 2023Quote: ... Whole blood was collected in 2% SDS Queens lysis buffer [23] and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen). All research was approved by the Institutional Animal Care and Use Committee at Columbia University (AC-AAAW6451) ...
-
bioRxiv - Genomics 2023Quote: ... to the eluted samples and digestion was carried out for 2 hours at 55°C followed by PCR purification (Qiagen). Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from 2 h and 10 h RPMI-grown and macrophage-internalized Cg cells using the RNeasy kit (Qiagen), followed by DNase I digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Crystals were grown at 30°C by the hanging drop vapor diffusion method using 2 μL sample drops and 300 μL crystallization solution in a sealed chamber (EasyXtal 15-Well Tool, Qiagen). Crystals were soaked for 1h (for the Na structure or with the dibromo Intronistat B derivative ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from kidneys of three independent biological samples for each age (E17.5, 2 months) and genotype using an RNeasy Mini Kit (Qiagen 74104) with on-column DNAse I treatment ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: Total RNA was extracted from 2-week-old seedlings grown on an MS plate using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Genetics 2023Quote: ... Digests were incubated for 2 hours at 37°C then purified using a QiaQuick PCR purification kit (Qiagen Cat#28106). Fragments of 2100 bp were size-selected using a SageELF instrument (Sage Science ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted directly into 2-Mercaptoethanol-containing RLT buffer and RNA was extracted using a RNeasy Mini kit (Qiagen). The cell populations used for RNA sequencing are summarized in Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Pathology 2023Quote: ... RNA from CD4+ T cells (2×106 cells per condition) was extracted by using the RNeasy Plus Mini kit (QIAGEN). Extracted total RNA was quantified using the Qubit broad range RNA assay ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Microbiology 2024Quote: ... The filtrate was transferred to ultra-clean 2 mL tubes and 280 µL were collected for nucleic acid extraction using the QIAamp Viral RNA mini kit (Qiagen). The extract was eluted in a final volume of 40 µL and stored at -80 °C.
-
bioRxiv - Molecular Biology 2024Quote: ... and 8 liver samples (2 from each lobe) were obtained on necropsy and processed with the DNeasy Blood and Tissue Kit (QIAGEN) as per the manufacturer’s instructions to isolate genomic DNA ...
-
bioRxiv - Immunology 2024Quote: ... Expression of target ncRNAs in CH12F3 and primary B cells were inhibited by 2 µM miRCURY LNA miRNA Inhibitors (339131, Qiagen), anti-miR-5099 (GGAGCACCACATCGATCTAA-FAM) ...
-
bioRxiv - Immunology 2024Quote: ... Overexpression of miR-5099 in CH12F3 was achieved by transfecting 2 µM of miR-5099 miRCURY LNA miRNA mimic (Qiagen) by electroporation using Lonza 4D-Nucleofector and cell line SF kit following manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was extracted from the mouse blood sampled after feeding the mosquitoes (Barcode input 2) using DNeasy Blood and Tissue Kit (Qiagen). The parasite gDNA was extracted from the infected mosquito midguts 14 days post-infection (Barcode output ...
-
bioRxiv - Molecular Biology 2024Quote: ... and HET(2)) and four biological replicates of PA-1 (WT and HET) cells was extracted using miRNeasy Mini Kit (Qiagen) followed by on-column DNAse digestion ...
-
bioRxiv - Developmental Biology 2024Quote: ... approximately 2×106 cells per well were washed with cold PBS and lysed using Buffer RLT (Qiagen, catalog no. 79216). RNA extraction was performed according to the manufacturer’s protocol (RNeasy Mini Kit ...
-
bioRxiv - Immunology 2024Quote: ... was added to each tube and homogenized at 30 rev/s for 3 minutes for 2 rounds using a tissue homogenizer/lyser (#9003240, Qiagen). Kidney extracts were centrifuged at 17,000 RCF for 10 minutes and the supernatant was transferred to a 1.5 mL microcentrifuge tube and kept over ice for 1-2h ...
-
bioRxiv - Genetics 2024Quote: ... DNA samples (70–80 oocytes and 7–10 blastocysts per sample) were subjected to bisulfite conversion through 2 µg carrier RNA (QIAGEN). Nested PCR was performed using EpiTaq HS with the primers listed in Supplementary Table 4 ...
-
bioRxiv - Genetics 2024Quote: ... yeast plasmid DNA was extracted from 5x107 cells harvested off of galactose and final glucose plates of replicates 2 and 3 using Qiaprep Spin Miniprep Kit (QIAGEN). We amplified the 200-bp repair template region from the initial E ...
-
bioRxiv - Genomics 2024Quote: ... The amplicon library pools were isolated based on size by gel electrophoresis using a 2% agarose gel and then purified using QIAEX II Gel Extraction Kit (QIAGEN) and using 30uL of QIAEX II beads for each sample ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was incubated at 37°C for 2 hours and RNA transcripts were then purified using the RNeasy MinElute Cleanup Kit (Qiagen). Concentrations of purified RNA were determined using a DS-11 FX+ Spectrometer/Flourometer (DeNovix).
-
bioRxiv - Physiology 2024Quote: ... was mechanically homogenised in TRI reagent with a 5 mm steel bead at 30 Hz for 2 x 30 s (TissueLyser II, Qiagen) then centrifuged for 10 min at 10,000 g ...
-
bioRxiv - Microbiology 2024Quote: ... The footpad was ground in 1 mL of DMEM containing 2% FBS with steel beads using a Tissue-Lyser II (Qiagen) and debris was clarified by centrifugation at 8,000 x g for 10 minutes ...
-
bioRxiv - Neuroscience 2024Quote: Cortical brain tissue was homogenised in TBS (with cOmplete mini protease inhibitor cocktail) for 2 minutes at 200 Hz using Tissue Lyser II (Qiagen), centrifuged at 31,000 g for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Faeces was collected in pre-weighed tubes containing 1 ml PBS and homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). Mice were euthanised at indicated time-points ...
-
bioRxiv - Physiology 2024Quote: ... weighed and homogenized 1:180 (weight:volume, mg:µL) in homogenization buffer (50 mM Triethanolamine and l mM EDTA) with 2 tungsten beads (Qiagen, Cat. #69997) using a Tissue Lyser (Qiagen Cat ...
-
bioRxiv - Neuroscience 2024Quote: BV-2 cells and primary mouse astrocytes were harvested and RNAs were extracted using the RNeasy Kit (Qiagen, Hilden, Germany) following the manufacturer’s directions ...
-
bioRxiv - Immunology 2024Quote: The expressions of 84 innate and adaptive immune genes in the lungs of SARS-CoV-2 infected mice and Sham were determined using RT2 ProfilerTM PCR array kit (Cat#: PAMM-052ZC-24, Qiagen) 39 ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted from cells harvested at three days or 2 weeks post nucleofection using the RNeasy plus kit (Qiagen) as per the manufacturer’s instructions and quantified by nanodrop ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Reverse transcription of 1–2 μg of RNA for cDNA synthesis was carried out using the Omniscript RT Kit (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was isolated from both J-Lat and C J-Lat cells by lysing 2 x 106 cells using the AllPrep DNA/RNA Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...