Labshake search
Citations for Qiagen :
751 - 800 of 10000+ citations for Human Protein FAM40B FAM40B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified under non-denaturing conditions using Ni-NTA resin (Qiagen) at 4 °C according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Digested protein was mixed with 3 ml of NTA super-flow resin (Qiagen) that had been pre-equilibrated in wash buffer ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were then lysed in protein isolation buffer using a tissue-lyser (Qiagen). Protein concentration was measured by Bradford assay ...
-
bioRxiv - Biophysics 2023Quote: ... His6-MBP-HNRNPH2 proteins were first purified using Ni-NTA Agarose (#30230, Qiagen) and eluted with buffer containing 250 mM imidazole pH 7.8 (#79227 ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Nickel sepharose according to the manufacturer’s instructions (QIAGEN). The purified recombinant protein was dialyzed overnight against dialysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were purified by immobilized metal affinity chromatography using Ni–NTA agarose (Qiagen) pre-equilibrated with lysis buffer in individual Econo-Pac gravity-flow columns (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: SAINT Express protein hits were analyzed using Ingenuity Pathway Analysis (IPA) software (Qiagen). Significant hits were analyzed and enrichment z-score was calculated for different pathways ...
-
bioRxiv - Neuroscience 2023Quote: ... The recombinant TDP-43 proteins were purified over Ni-NTA agarose beads (Qiagen) and eluted using 50 mM HEPES (pH 7.5) ...
-
bioRxiv - Microbiology 2023Quote: ... All nucleotide and protein sequences were analyzed using CLC Main Workbench 8.1.2 (Qiagen).
-
bioRxiv - Bioengineering 2024Quote: ... Each His-tagged protein in media was captured with Ni-NTA resin (Qiagen) and eluted with DPBS containing 150 mM imidazole.
-
bioRxiv - Neuroscience 2023Quote: Protein pathway analysis was conducted on DEP using Ingenuity Pathway Analysis (IPA, Qiagen) and Gene Ontology (GO ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity purified using Ni-NTA agarose (Qiagen; Table S4), eluted with 50 mM Tris-base ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA (200 ng) was used for quantitative PCR with the Human Cellular Senescence RT2 Profiler™ PCR Array (Qiagen) containing 84 key genes involved in the initiation and progression of the biological process causing cells to lose the ability to divide ...
-
bioRxiv - Molecular Biology 2019Quote: Preliminary screening for the presence of serum exosomal miRNAs was determined using a miScript human miFinder PCR array (MIHS-001Z, Qiagen). RNA was converted to cDNA using miScript RT kit (218060) ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared cDNA was preamplified using the RT2 PreAMP Primer Mix for Human and Mouse PCR Array (Qiagen, PBH-181Z). cDNA was analyzed by RT-qPCR using a Qiagen RT2 profiler custom panel (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... Synthetized cDNA was subjected to a PCR array specific for the human antiviral response (RT² Profiler PCR array – PAHS-122Z, SA Biosciences, Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Microbiology 2021Quote: ... mRNA-Seq FASTQ reads were mapped to the human reference genome (Homo sapiens v81; hg38) using default options on CLC Genomics Workbench 11 (Qiagen). Total gene reads (with at least 1 read count ...
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... both hNS1 and hNP cells were transfected with human miRNA-mimics (double stranded RNAs that mimic mature endogenous miRNAs, Procured from Qiagen) of the mentioned ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... The specific bands were purified using gel purification kit (Qiagen gel purification kit). All these DNA amplified products were γ-32P radiolabelled by using T4 polynucleotide kinase enzyme using [γ-32P] ATP as the substrate with the reaction condition of 37°C for 30 min followed by 65°C for 25min enzyme inactivation period ...
-
bioRxiv - Bioengineering 2019Quote: ... Total RNA extraction was performed using a standard kit (RNeasy mini kit, Qiagen). RNA concentration was quantified (ND-1000 ...
-
bioRxiv - Bioengineering 2020Quote: ... DNA was extracted using a commercially available kit (Qiagen DNeasy Blood & Tissue Kit). Afterwards ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RNA was extracted using a commercial kit (RNeasy Micro kit, Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted using a commercial kit (Qiagen Buccal Cell and DNAeasy Kit), as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and using the RNeasy Mini kit and the RNAase free DNAase kit (Qiagen). After RNA extraction ...
-
bioRxiv - Microbiology 2020Quote: We used the DNeasy PowerWater Kit and the DNeasy PowerSoil Kit (Qiagen, Germany) according to the manufacturer’s instructions to extract DNA from the water and soil samples ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated using RNeasy Micro Kit or RNeasy Mini Kit (Qiagen). After initial quality control using Agilent’s Bioanalyzer sequencing libraries were prepared from 500ng of total RNA per sample following Roche’s “KAPA stranded mRNA Seq” library preparation protocol for single indexed Illumina libraries ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated with RNeasy Micro Kit or RNeasy Mini Kit (Qiagen). cDNA was synthesized using 1μg of mRNA with SuperScript™ III Reverse Transcriptase (Invitrogen 18080044) ...
-
bioRxiv - Neuroscience 2021Quote: ... Bacterial DNA was extracted using a specific kit (QIAamp Powerfecal DNA kit, Qiagen), and its concentration was quantified by Nanodrop 2000 C Spectrophotometer (ThermoFisher Scientific).
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated using RNeasy Mini kit or RNeasy Micro kit (QIAGEN). cDNA was synthesized with Oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid DNAs were purified using QIAfilter Plasmid kits (Midi pre kit, Qiagen #12243) following manufacturer protocol ...
-
bioRxiv - Genetics 2023Quote: Total genomic DNA was extracted using a commercial kit (DNeasy Tissue Kit, QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA was isolated via commercially available kit (Qiagen, RNeasy Mini Kit Cat# 74104) by lysing the cells in the vessel as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Resulting RNA was purified using a spin-column kit (RNeasy mini kit, QIAGEN) and 120 pmol of sgRNA were complexed with 100 pmol of recombinant SpCas9 protein at RT for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: RNAs were isolated using the RNeasy mini kit mirVana RNA isolation kit (Qiagen). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA was extracted using a commercially available kit (QIAGEN RNeasy mini kit). RNA was stored at −80°C until submission to the University of Minnesota Genomics Center (UMGC).
-
bioRxiv - Physiology 2023Quote: ... Total RNA was isolated with an RNA purification kit (Qiagen miRNeasy mini kit) and DNase treatment to remove DNA contamination.
-
bioRxiv - Evolutionary Biology 2024Quote: High molecular DNA was extracted using the kit MagAttract HMW DNA kit (Qiagen) following manufacturer’s guidelines ...