Labshake search
Citations for Qiagen :
751 - 800 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Physiology 2022Quote: Cells were lysed directly in the plate using Buffer RLT (Qiagen) with 10uL/mL 2-mercaptoethanol following a quick PBS rinse ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plate was then processed in the PyroMark Q24 pyrosequencer (Qiagen). Results were analyzed with PyroMark Q24 Advanced 3.0.1 software ...
-
bioRxiv - Immunology 2023Quote: ... RT qPCR was conducted with custom array plates (330171, Qiagen, Canada) using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... and a 96-well PowerMag Glass Bead plate (Qiagen, Hilden, Germany). The Glass Bead Sterilizer was turned on ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCl buffer ...
-
bioRxiv - Genomics 2021Quote: Amplicon libraries for viral genome sequencing were prepared using QIAseq FX DNA Library Kit and QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 180475, cat. no. 333896) as instructed by the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... double-digoxigenin locked nucleic acid probe (RNO-MIR-124-3P: CATTCACCGCGTGCCTTA, Tm: 84°C, 339111 YD00614870-BGC, miRCURY LNA™ miRNA Detection Probe, Qiagen) was used at a final concentration of 30 nM ...
-
bioRxiv - Cell Biology 2023Quote: ... Reactions were run three times in quadruplicates in the Rotor-Gene Q Real-Time PCR Detection System (QIAGEN, Germantown, Maryland, USA) with the following reaction conditions ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2019Quote: ... low RFP and high RFP populations were sorted into 350 μl of RLT lysis buffer (QIAGEN) with 2 μl of β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Microbiology 2022Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Microbiology 2023Quote: High-quality DNA from the antagonistic gut strains was extracted using QIAamp DNA minikit (Qiagen, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The aqueous phase was isolated through centrifugation in MaXtract high density tubes (Qiagen, 50-727-738). DNA was precipitated at −20°C by the addition of 100% ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... temporaria frogs were homogenized and lysed using a Qiagen High-Frequency Tissue Lyser2 (Qiagen, Hilden, Germany) with lysis buffer and stainless-steel lysis beads at 2,000 Hz for 4 min ...
-
bioRxiv - Immunology 2023Quote: ... The peak fractions were passed through Pierce™ High-Capacity Endotoxin Removal Resin (Qiagen, Hilden, Germany) to remove any remaining lipopolysaccharides (LPS) ...
-
bioRxiv - Microbiology 2023Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were harvested from 24-well plates in 350μL RLT Plus (Qiagen) supplemented with 1% beta-mercaptoethanol after an 8-hour induction with 10nM E2 or DMSO ...
-
bioRxiv - Microbiology 2019Quote: ... each plate contained the same amount of the following siRNAs from Qiagen as knockdown controls ...
-
bioRxiv - Plant Biology 2020Quote: ... Initial hits were further optimized in 24-well sitting-drop plates (Qiagen) using as reservoir solution 18-22 % PEG 3350 ...
-
bioRxiv - Genetics 2020Quote: ... the deepwell plates were filled with the following reagents: wash buffer (Qiagen), 80% Ethanol ...
-
bioRxiv - Immunology 2020Quote: ... Plates were spun down and cell pellets were resuspended in Qiazol (Qiagen) for RNA extraction ...
-
bioRxiv - Neuroscience 2023Quote: ... the deepwell plates were filled with the following reagents: wash buffer (Qiagen), 80% Ethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 96-well plates or a Rotor-Gene Q (Qiagen, Hilden, Germany) in 4-tube strips.
-
bioRxiv - Cell Biology 2022Quote: ... Three technical replicates of each biological sample were analysed using a Rotor-Gene Q 2plex (Qiagen, Rotor-Gene-Q Pure Detection Software). Control reactions without cDNA template (qPCR grade water used instead ...
-
bioRxiv - Microbiology 2019Quote: ... and the variants (single nucleotide changes and small deletion up to 50 nucleotides) were detected with the Fixed Ploidy Variant Detection tool in CLC Genomics Workbench version 9 (CLC, Bio-QIAGEN, Aarhus, Denmark). Variants falling in PE/PPE family genes were excluded from the analysis.
-
bioRxiv - Evolutionary Biology 2021Quote: ... For the detection of phosphorylated Serine residues a TBS solution with a 1:100 dilution of the Anti-Phospho-Serin Antibody (Qiagen, Hilden, Germany) was used ...
-
bioRxiv - Microbiology 2020Quote: ... Gene expression quantitation was determined using Sybr Green (Perfecta) and The CFX96 real-time polymerase chain reaction (PCR) detection system (Qiagen, Venio, NL) was used for gene expression analysis ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).