Labshake search
Citations for Qiagen :
751 - 800 of 2805 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with 5-mm stainless steel beads (Qiagen #69989). RNA extraction was carried out with the NucleoSpin RNA kit (Macherey-Nagel ...
-
A conserved RNA switch for acetylcholine receptor clustering at neuromuscular junctions in chordatesbioRxiv - Developmental Biology 2024Quote: ... 5 U/μL HotStarTaq Plus DNA polymerase (Qiagen) (0.4 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mm stainless steel beads (Qiagen, Hilden, Germany) and a TissueLyser (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: QIAcuity Probe 5 mL PCR Kit (Qiagen, 250102)
-
bioRxiv - Cancer Biology 2024Quote: ... was achieved from frozen tissue biopsies upon homogenization with stainless steel beads (3–7 mm mean diameter) using TissueLyser II (QIAGEN; 20” at 30 Hz, for 2 cycles(20)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were plated at a density of ∼100,000 cells/well in a 24 well plate and transfected the following day with 500 ng of midi-prepped endotoxin-free plasmid DNA (Qiagen, Germantown, MD, USA) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... The reaction mixture was incubated at 37°C for 24 hours and subsequently underwent RNA clean-up using a column-based purification (Qiagen, product number 74104). The purified RNA was eluted in nuclease-free water (Qiagen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and WPMY1 parental cell lines were seeded in 6-well plates and grown for 24 hours to a confluency of 70% to 90% before RNA was extracted using an RNeasy RNA extraction kit (Qiagen, Venlo, the Netherlands). Samples were prepared in triplicate ...
-
bioRxiv - Systems Biology 2023Quote: The tissues were cut into 30-35 mg pieces and homogenized using an automated homogenizer (Precelly®24; Bertin Technologies, France) with QIAzol® lysis reagent (Qiagen, USA). The RNA extraction was then performed according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... 800 μL of the sample lysate was collected and transferred into the provided PowerBead Pro Tube and mechanically lysed using PowerLyzer® 24 Homogenizer (110/220 V) (Catalog number 13155, QIAGEN, Hilden, Germany) at 3000 rpm for 30 seconds ...
-
bioRxiv - Microbiology 2024Quote: ... DNA from both water and sediment samples was extracted in duplicate within 24 hours of sampling using the DNeasy® PowerWater® Kit (Qiagen, Germany) and DNeasy® PowerSoil® Pro Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Ni-NTA column packed with 20 ml of Ni-NTA resin (Qiagen). The Ni-NTA column was first washed with loading buffer A (20 mM TRIS-HCl pH 7.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 μL of Proteinase K (Catalog No. 19133, QIAGEN, Hilden, Germany). Samples were then incubated for at least 12h at 65°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... miRNA silencing inhibitors: miScript inhibitor negative control (20 nmol, Qiagen, cat# 1027272), anti-hsa-miR-181a-5p miScript miRNA Inhibitor (20 nmol ...
-
bioRxiv - Microbiology 2021Quote: ... The NGS sequence data was analysed using CLC Genomic Workbench 20 (Qiagen) using standard parameters ...
-
bioRxiv - Cell Biology 2022Quote: ... 20 μg of RNA was treated twice with 1U of DNaseI (Qiagen) per μg of RNA ...
-
bioRxiv - Biochemistry 2022Quote: ... and supernatant was mixed with 20 mL of Ni-NTA resin (Qiagen) that had been equilibrated with binding buffer (50 mM NaPi ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.
-
bioRxiv - Genomics 2021Quote: ... Pools were eluted in 20 µl of EB (Qiagen Catalogue No. 19086). The barcoded pool was quantified using Qubit High Sensitivity kit (Catalogue No ...
-
bioRxiv - Microbiology 2021Quote: ... in fastq format and analyzed using CLC Genomics Workbench 20 (Qiagen Bioinformatics). Reads were imported and failed reads were removed using the Illumina Paired Importer tool ...
-
bioRxiv - Genomics 2022Quote: ... and 20 μL of Proteinase K (Catalog No. 19133, QIAGEN, Hilden, Germany). Samples were then incubated for at least 12 hours at 65°C ...
-
bioRxiv - Microbiology 2024Quote: ... The raw data was analyzed in CLC Genomic Workbench v.20 (Qiagen), where raw reads were trimmed and aligned to the reference sequences to analyze the genetic changes ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq fastq data was processed using CLC Genomics Workbench 20 (Qiagen). Illumina sequencing adaptors were trimmed ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs pre-mixed with 20 μl of HiPerFect transfection reagent (301704, Qiagen) on free-serum media ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA was extracted using a ‘Genomic-tip 20/G’ kit (Qiagen) and sequenced with 150 bp paired-end ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA extracts were further purified on the GenomicTip G/20 column (Qiagen) by the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... the supernatant was loaded on equilibrated Genomic-tip 20/G column (QIAGEN) and washed and eluted according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA extraction (20 µL) with RNeasy Plus Mini Kit (QIAGEN, # 74134).
-
bioRxiv - Microbiology 2024Quote: ... a Genomic-tip 20/G kit (Qiagen Benelux BV, Venlo, The Netherlands) was used as per protocol.
-
bioRxiv - Biochemistry 2024Quote: ... Genomic DNA was extracted using the Genomic tip 20/G kit (Qiagen) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and 20 mg were homogenized using metal beads with Tissue Lyser (Qiagen) in QIAzol solution (#79306 ...
-
bioRxiv - Microbiology 2024Quote: ... The sequencing data were processed with the CLC Genomics Workbench 20 (Qiagen), aligning reads to the C ...
-
bioRxiv - Immunology 2024Quote: ... pH 8) and 30 μl of 20 mg/ml Proteinase K (Qiagen) were added to the cells in a 15 ml falcon tube and incubated at 550C overnight to lyse the cells and de-crosslink PFA fixation ...
-
bioRxiv - Systems Biology 2024Quote: ... Ligations were cleaned using the MinElute PCR Purification Kit (QIAGEN, 20-28004), with an additional wash with the PE buffer to avoid high salt concentration ...
-
bioRxiv - Genomics 2024Quote: ... the liquid was transferred to a Qiagen Genomic-tip 20 (Qiagen, Venlo) and DNA was extracted as per the manufacturer’s protocols.
-
bioRxiv - Cancer Biology 2024Quote: Cells were transfected with 20 nM siRNA (siTFE3 #sc-38507, siMITF (QIAGEN, custom siRNA sequence ...
-
Pleiotropy in FOXC1-attributable phenotypes involves altered ciliation and cilia-dependent signalingbioRxiv - Genetics 2020Quote: ... 10 μg/ml aprotinin and 10 μg/ml leupeptin) and passed through QIAshredder columns (Qiagen). Obtained protein samples were normalised ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 500 µL AP1 lysis buffer and 10 µL proteinase K (10 mg mL-1; Qiagen) were added to each tube ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from a subset of 15 samples using the RNA PowerSoil Total RNA isolation kit (Qiagen). Soil samples (8 g ...
-
bioRxiv - Immunology 2021Quote: ... and low molecular weight DNA isolated for downstream analysis using a 1.2x volumes AMPureXP SPRI-beads and eluted in 15 μl EB buffer (Qiagen). ATAC-seq libraries were amplified using 5 μl each of the i5 and i7 Nextera Indexing primers and 25 μl of 2x HiFi HotStart ReadyMix (Roche Diagnostics ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was isolated from mycelia on a Biosprint 15 instrument using Biosprint DNA Plant Kit (QIAGEN, Hilden, Germany) as per manufacturer’s instructions ...