Labshake search
Citations for Qiagen :
751 - 800 of 955 citations for Bis 2 Chloroethyl Ether D8 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Purified CD4+FYP+ Treg cells were stimulated with Cell Stimulation Cocktail (eBioscience) for 2 hrs and lysed in RLT buffer (Qiagen) containing 1% 2-mercaptoethanol (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Crystals were grown at 30°C by the hanging drop vapor diffusion method using 2 μL sample drops and 300 μL crystallization solution in a sealed chamber (EasyXtal 15-Well Tool, Qiagen). Crystals were soaked for 1h (for the Na structure or with the dibromo Intronistat B derivative ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The supernatant was then purified using a modified PB buffer and eluted using 2 washes in 18 μl buffer EB (QIAGEN) - with 3 min of incubation time at 37°C (Dabney et al ...
-
bioRxiv - Genetics 2023Quote: ... Whole blood was collected in 2% SDS Queens lysis buffer [23] and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen). All research was approved by the Institutional Animal Care and Use Committee at Columbia University (AC-AAAW6451) ...
-
bioRxiv - Genomics 2023Quote: ... to the eluted samples and digestion was carried out for 2 hours at 55°C followed by PCR purification (Qiagen). Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from 2 h and 10 h RPMI-grown and macrophage-internalized Cg cells using the RNeasy kit (Qiagen), followed by DNase I digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... RNA from CD4+ T cells (2×106 cells per condition) was extracted by using the RNeasy Plus Mini kit (QIAGEN). Extracted total RNA was quantified using the Qubit broad range RNA assay ...
-
bioRxiv - Neuroscience 2024Quote: ... with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and TissueRuptor II (Qiagen) homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 mg of frozen brain was taken per mouse sample and lysed with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and was homogenised using a TissueRuptor II (Qiagen). Zebrafish larvae were similarly extracted ...
-
bioRxiv - Molecular Biology 2023Quote: Bulk-RNA free of genomic DNA for RT-qPCR analysis was extracted from cell pellets (≤ 2 x 106 cells) using the RNeasy plus spin-column purification kit (Qiagen) and performed using the Qiacube liquid handler (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted directly into 2-Mercaptoethanol-containing RLT buffer and RNA was extracted using a RNeasy Mini kit (Qiagen). The cell populations used for RNA sequencing are summarized in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from kidneys of three independent biological samples for each age (E17.5, 2 months) and genotype using an RNeasy Mini Kit (Qiagen 74104) with on-column DNAse I treatment ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Genomics 2023Quote: Total DNA from enhancer screening library transduced HUDEP-2 cells was isolated using the DNeasy Blood & Tissue kit (Qiagen, 69504) and the enhancer inserts were PCR amplified using the following primers:
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from the root tip (2 cm apex) of the primary root using the RNeasy Plant Mini Kit (QIAGEN). RNA-seq was performed by the Montpellier GenomiX Platform (MGX ...
-
bioRxiv - Plant Biology 2024Quote: ... from infected leaf material or from urediniospores of non-target rust species (Table 2) with the DNeasy Plant mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Genetics 2023Quote: ... Digests were incubated for 2 hours at 37°C then purified using a QiaQuick PCR purification kit (Qiagen Cat#28106). Fragments of 2100 bp were size-selected using a SageELF instrument (Sage Science ...
-
bioRxiv - Genetics 2023Quote: Total RNA was extracted from 2-week-old seedlings grown on an MS plate using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The amplicon library pools were isolated based on size by gel electrophoresis using a 2% agarose gel and then purified using QIAEX II Gel Extraction Kit (QIAGEN) and using 30uL of QIAEX II beads for each sample ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Genetics 2023Quote: ... The leaves were ground in liquid nitrogen and powder was resuspended in 2 ml of RLT buffer from RNeasy Plant Mini kit (Qiagen). For each sample ...
-
bioRxiv - Neuroscience 2024Quote: ... were added to each tube and samples were homogenized for 2×90s at 20 Hz using a TissueLyser II (Qiagen). Next ...
-
bioRxiv - Genetics 2024Quote: Tail clips were taken from 2 month postfertilization (mpf) zebrafish and DNA was extracted using the DNeasy Blood and tissue kit (Qiagen). DNA was PCR amplified with Q5 high fidelity DNA polymerase (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... DRG and paw skin RNA was extracted using a RLT buffer:2-mercapto ethanol mixture in a 100:1 ratio/RNeasy (Qiagen) RNA mini kit according to the manufacturer’s instructions and spinal cord and spleen RNA was extracted using TRizol (Invitrogen)/RNeasy RNA mini kit ...
-
bioRxiv - Immunology 2024Quote: ... slides from 25 epidemic KS and 2 endemic KS tumor biopsies and 5 samples of uninvolved skin using the AllPrep DNA/RNA FFPE Kit (QIAGEN). Gene expression analysis was performed on RNA samples on the Nanostring platform (Nanostring Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were directly lysed in the well using 350 µL of lysing solution (1% 2-mercaptoethanol in Buffer RLT; RNeasy Mini Kit, 74106, Qiagen) by pipetting over the well ...
-
bioRxiv - Microbiology 2024Quote: ... treated with our LRA panel in the presence or absence of KL-2 was carried out with an RNeasy kit (Qiagen), with the optional on-column deoxyribonuclease I digestion step ...
-
bioRxiv - Molecular Biology 2024Quote: ... The swabs were removed after heat incubation at 56 °C for 2 hours by transferring samples including swab material to QIAshredder tubes (Qiagen) and centrifugation at 12,000 rcf for 2 min.
-
bioRxiv - Plant Biology 2024Quote: ... The fresh leaf discs were transferred to a 2 mL tube containing a 5 mm stainless steel bead and 500 µL buffer RLT (QIAGEN). The leaf discs were disrupted using a TissueLyser LT (QIAGEN ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...