Labshake search
Citations for Qiagen :
751 - 800 of 1947 citations for 6 Chlorospiro chroman 2 4' piperidin 4 one hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmids of 5 µg were transfected into 6x10[6] S2 cells using Effectene (Qiagen) and incubated for 3 days ...
-
bioRxiv - Immunology 2021Quote: ... and harvested for RNA extraction after 6 hours of incubation using RNAeasy kits (Qiagen). cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: HEK293Ts were plated in 6 well plates and transfected using Effectene Transfection Reagent (Qiagen) according the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Genomics 2022Quote: ... After overnight proteinase K digestion in Lysis Buffer (Bionano Genomics) and one hour treatment with RNAse A (Qiagen), plugs were washed four times in 1x Wash Buffer (Bionano Genomics ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was extracted from overnight cultures issued from one isolated colony following standard protocols (QIAGEN DNAeasy, Hilden, Germany). As controls ...
-
bioRxiv - Cell Biology 2021Quote: One µg of total RNA extracted from ELT3-V cells with the RNeasy Mini Kit (Qiagen, Germantown, MD) was reverse-transcribed into cDNA using amfiRivert cDNA Synthesis Master Mix (GenDEPOT ...
-
bioRxiv - Plant Biology 2021Quote: ... Sets of 95 ligations were pooled into one sample and purified using QIAquick PCR Purification Kit (Qiagen, Germany). The pooled ligation mixtures (5 μL ...
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Pathology 2019Quote: ... RNA was extracted from PRRSV and one replicate of CDV using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...
-
bioRxiv - Genetics 2020Quote: ... reverse primers 852Rb-AGGAAGATAGAGAAAGAGCAACC and 852Rc-AGGAAGATAGAAAAGGAGCAACC using QIAGEN One-Step RT-PCR kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... 5μL of the resulting DNA underwent one or more displacement amplifications using the Repli-G MDA kit (Qiagen), to enrich microbial DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microgram of genomic DNA was bisulfite converted with the EpiTect® Fast 96 DNA Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA extraction was carried out using one of the following methods: 1) QIAmp DNA Mini Kit (Qiagen, Germany); 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... One hour of tagmentation at 37°C was followed by DNA extraction using MinElute PCR Purification Kit (Qiagen). Extracted DNA was subjected to PCR amplification using unique primers sets (Nextera XT v2 Full set (N7-S5)) ...
-
bioRxiv - Genetics 2020Quote: ... 20 µl RT-PCRs were performed as per the manufacturer’s instructions using the Qiagen One-Step RT-PCR kit (210210, Qiagen) and the following primers ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We extracted DNA from one female (ZW) butterfly per population using Qiagen’s MagAttract HMW DNA extraction kit (Qiagen, inc.) following the manufacture’s suggested protocol ...
-
bioRxiv - Genomics 2020Quote: ... The total RNA solution from 12 wells are passed through one column of RNeasy mini kit (cat.74104, QIAGEN) to obtain approximately 100 g of purified total RNA ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA from Arabidopsis plants was extracted from one month old rosette leaves using RNeasy plant mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription-PCR (RT-PCR) was carried out with total RNA using the one-step RT-PCR kit (QIAGEN) according to the supplier’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and microbial Eukaryotic abundance with a QIAcuity One 5-plex digital PCR (dPCR) instrument (Qiagen Inc. USA, Germantown, MD). dPCR samples represented both the 416 Fire —across SBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real time one step qRT-PCR was carried out using the QuantiTect SYBR® Green RT-PCR Kit (Qiagen) according to manufacturer’s instructions before analysis on the 7900 PCR machine (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2020Quote: ... the reactions were pooled in sets of four and purified on one column each (MinElute PCR purification kit, Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of RNA from each sample was used for cDNA synthesis by using QuantiTect Reverse Transcription Kit (QIAGEN). Quantitative PCR was performed using SYBR Green PCR Master Mix in QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... After another one-hour incubation bacteria were pelleted and total RNA was extracted using the miRNeasy mini kit (QIAGEN). RNA samples were treated with RNase-Free DNase (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: One-tenth of a TG single cell suspension was used for DNA extraction using the QIAamp DNA Kit (Qiagen). TaqMan qPCR was performed in duplicate on the 7500 Real-Time PCR system using 2X PCR Universal Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... which contained 5 μl of sort buffer consisting of (1X Qiagen One-step RT PCR Buffer (Qiagen, Hilden, Germany), 0.1 mM dithiothreitol (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: Total DNA was extracted from muscle tissue of one male fish using a QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV2 subgenomic viral RNA was quantified using primer probe sets as previously described (Wölfel et al., 2020) and Quantifast One-Step RT-PCR master mix (Qiagen) on a QuantStudio 3 or 5 instrument (ThermoFisher) ...
-
bioRxiv - Systems Biology 2022Quote: ... genomic DNA was extracted for pelleted cell fractions with one of the following: DNeasy Blood & Tissue Kit (Qiagen #69504) for fractions with fewer than 5 x 106 cells ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated one week after the initial passage using Trizol/Chloroform extraction and RNeasy Mini kit (Qiagen) purification ...
-
bioRxiv - Biophysics 2022Quote: ... HEK-293 cells were seeded in Labtek chambers (#1.5 glass-bottom) one day in advance and then transfected with Effectene Transfection Reagent (QIAGEN) according to the manufacturer’s protocol.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Allele-specific expression was measured using RT-ddPCR with the One-Step RT-ddPCR Advanced Kit for Probes (Qiagen) on a QX200 ddPCR Droplet Reader (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplified fragments were sequenced (Secugen S.L., Madrid) and analysed using CLC Sequence Viewer 6 (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... for 6 h at 55 °C followed by purification with a Qiaquick PCR Kit (Qiagen). Libraries were prepared using a MicroPlex Library Preparation Kit (Diagenode ...
-
bioRxiv - Genetics 2022Quote: ... Cells were transfected in 6-well plates at 80% confluency using Effectene transfection reagent (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA (at least from 2.5* 10^6 cells) was purified onto RNeasy columns (Qiagen) and treated on-column with DNase (Qiagen) ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 days after being transferred into SIM medium using miRNeasy Mini Kit (QIAGEN, 217004). High-quality RNA was used to prepare sequencing libraries with the MGIEasy RNA library preparation kit ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...